https://launchpad.net/ubuntu/+source/ataqv/1.3.1+ds-2build1/+build/27576134 RUN: /usr/share/launchpad-buildd/bin/builder-prep Kernel version: Linux lcy02-amd64-063 5.4.0-169-generic #187-Ubuntu SMP Thu Nov 23 14:52:28 UTC 2023 x86_64 Buildd toolchain package versions: launchpad-buildd_235~645~ubuntu20.04.1 python3-lpbuildd_235~645~ubuntu20.04.1 sbuild_0.79.0-1ubuntu1 git-build-recipe_0.3.6 git_1:2.25.1-1ubuntu3.11 dpkg-dev_1.19.7ubuntu3.2 python3-debian_0.1.36ubuntu1.1. Syncing the system clock with the buildd NTP service... 19 Dec 15:07:33 ntpdate[1864]: adjust time server 10.131.248.1 offset 0.000373 sec RUN: /usr/share/launchpad-buildd/bin/in-target unpack-chroot --backend=chroot --series=noble --arch=amd64 PACKAGEBUILD-27576134 --image-type chroot /home/buildd/filecache-default/1fe94ca8758119221c8de2550665a1bb335bd6a9 Creating target for build PACKAGEBUILD-27576134 RUN: /usr/share/launchpad-buildd/bin/in-target mount-chroot --backend=chroot --series=noble --arch=amd64 PACKAGEBUILD-27576134 Starting target for build PACKAGEBUILD-27576134 RUN: /usr/share/launchpad-buildd/bin/in-target override-sources-list --backend=chroot --series=noble --arch=amd64 PACKAGEBUILD-27576134 'deb http://ftpmaster.internal/ubuntu noble main universe' 'deb http://ftpmaster.internal/ubuntu noble-security main universe' 'deb http://ftpmaster.internal/ubuntu noble-updates main universe' 'deb http://ftpmaster.internal/ubuntu noble-proposed main universe' Overriding sources.list in build-PACKAGEBUILD-27576134 RUN: /usr/share/launchpad-buildd/bin/in-target update-debian-chroot --backend=chroot --series=noble --arch=amd64 PACKAGEBUILD-27576134 Updating target for build PACKAGEBUILD-27576134 Get:1 http://ftpmaster.internal/ubuntu noble InRelease [240 kB] Get:2 http://ftpmaster.internal/ubuntu noble-security InRelease [74.9 kB] Get:3 http://ftpmaster.internal/ubuntu noble-updates InRelease [74.9 kB] Get:4 http://ftpmaster.internal/ubuntu noble-proposed InRelease [102 kB] Get:5 http://ftpmaster.internal/ubuntu noble/main amd64 Packages [1406 kB] Get:6 http://ftpmaster.internal/ubuntu noble/main Translation-en [515 kB] Get:7 http://ftpmaster.internal/ubuntu noble/universe amd64 Packages [15.0 MB] Get:8 http://ftpmaster.internal/ubuntu noble/universe Translation-en [6031 kB] Get:9 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 Packages [160 kB] Get:10 http://ftpmaster.internal/ubuntu noble-proposed/main Translation-en [44.9 kB] Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe amd64 Packages [1070 kB] Get:12 http://ftpmaster.internal/ubuntu noble-proposed/universe Translation-en [325 kB] Fetched 25.1 MB in 3s (9321 kB/s) Reading package lists... Reading package lists... Building dependency tree... Reading state information... Calculating upgrade... The following package was automatically installed and is no longer required: libunistring2 Use 'sudo apt autoremove' to remove it. The following NEW packages will be installed: libunistring5 The following packages will be upgraded: apt apt-utils base-files base-passwd bash bash-completion binutils binutils-common binutils-x86-64-linux-gnu bsdextrautils bsdutils coreutils cpp cpp-13 debianutils diffutils dpkg dpkg-dev fakeroot g++ g++-13 gcc gcc-13 gcc-13-base grep init init-system-helpers krb5-locales libapparmor1 libapt-pkg6.0 libargon2-1 libasan8 libatomic1 libaudit-common libaudit1 libbinutils libblkid1 libc-bin libc-dev-bin libc6 libc6-dev libcap-ng0 libcc1-0 libcryptsetup12 libctf-nobfd0 libctf0 libdb5.3 libdebconfclient0 libdpkg-perl libfakeroot libfdisk1 libffi8 libgcc-13-dev libgcc-s1 libgdbm-compat4 libgdbm6 libgnutls30 libgomp1 libgpg-error-l10n libgpg-error0 libgprofng0 libgssapi-krb5-2 libhwasan0 libidn2-0 libitm1 libk5crypto3 libkmod2 libkrb5-3 libkrb5support0 liblsan0 liblzma5 libmount1 libncursesw6 libnsl-dev libnsl2 libp11-kit0 libpam-modules libpam-modules-bin libpam-runtime libpam0g libpcre2-8-0 libperl5.36 libpng16-16 libproc2-0 libquadmath0 libreadline8 libseccomp2 libselinux1 libsemanage-common libsemanage2 libsepol2 libsframe1 libsmartcols1 libsqlite3-0 libssl3 libstdc++-13-dev libstdc++6 libsystemd-shared libsystemd0 libtinfo6 libtirpc-common libtirpc-dev libtirpc3 libtsan2 libubsan1 libudev1 libuuid1 libxxhash0 libzstd1 linux-libc-dev login lto-disabled-list mawk mount ncurses-base ncurses-bin openssl optipng passwd perl perl-base perl-modules-5.36 pinentry-curses procps readline-common systemd systemd-dev systemd-sysv sysvinit-utils tar ubuntu-keyring util-linux uuid-runtime xz-utils zlib1g 135 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. Need to get 111 MB of archives. After this operation, 6093 kB of additional disk space will be used. Get:1 http://ftpmaster.internal/ubuntu noble/main amd64 libnsl-dev amd64 1.3.0-3 [71.2 kB] Get:2 http://ftpmaster.internal/ubuntu noble/main amd64 libc6-dev amd64 2.38-3ubuntu1 [2114 kB] Get:3 http://ftpmaster.internal/ubuntu noble/main amd64 libc-dev-bin amd64 2.38-3ubuntu1 [20.3 kB] Get:4 http://ftpmaster.internal/ubuntu noble/main amd64 libtirpc-common all 1.3.4+ds-1 [7920 B] Get:5 http://ftpmaster.internal/ubuntu noble/main amd64 libtirpc-dev amd64 1.3.4+ds-1 [193 kB] Get:6 http://ftpmaster.internal/ubuntu noble/main amd64 libgssapi-krb5-2 amd64 1.20.1-5build1 [142 kB] Get:7 http://ftpmaster.internal/ubuntu noble/main amd64 libkrb5-3 amd64 1.20.1-5build1 [346 kB] Get:8 http://ftpmaster.internal/ubuntu noble/main amd64 libk5crypto3 amd64 1.20.1-5build1 [81.3 kB] Get:9 http://ftpmaster.internal/ubuntu noble/main amd64 libkrb5support0 amd64 1.20.1-5build1 [33.2 kB] Get:10 http://ftpmaster.internal/ubuntu noble/main amd64 libssl3 amd64 3.0.10-1ubuntu3 [1910 kB] Get:11 http://ftpmaster.internal/ubuntu noble/main amd64 libtirpc3 amd64 1.3.4+ds-1 [81.4 kB] Get:12 http://ftpmaster.internal/ubuntu noble/main amd64 libnsl2 amd64 1.3.0-3 [41.3 kB] Get:13 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 linux-libc-dev amd64 6.6.0-14.14 [1580 kB] Get:14 http://ftpmaster.internal/ubuntu noble/main amd64 libcc1-0 amd64 13.2.0-9ubuntu1 [48.0 kB] Get:15 http://ftpmaster.internal/ubuntu noble/main amd64 libgprofng0 amd64 2.41.50.20231214-1ubuntu1 [858 kB] Get:16 http://ftpmaster.internal/ubuntu noble/main amd64 libctf0 amd64 2.41.50.20231214-1ubuntu1 [83.2 kB] Get:17 http://ftpmaster.internal/ubuntu noble/main amd64 libctf-nobfd0 amd64 2.41.50.20231214-1ubuntu1 [86.3 kB] Get:18 http://ftpmaster.internal/ubuntu noble/main amd64 binutils-x86-64-linux-gnu amd64 2.41.50.20231214-1ubuntu1 [2510 kB] Get:19 http://ftpmaster.internal/ubuntu noble/main amd64 libbinutils amd64 2.41.50.20231214-1ubuntu1 [539 kB] Get:20 http://ftpmaster.internal/ubuntu noble/main amd64 binutils-common amd64 2.41.50.20231214-1ubuntu1 [258 kB] Get:21 http://ftpmaster.internal/ubuntu noble/main amd64 binutils amd64 2.41.50.20231214-1ubuntu1 [7696 B] Get:22 http://ftpmaster.internal/ubuntu noble/main amd64 gcc-13-base amd64 13.2.0-9ubuntu1 [45.2 kB] Get:23 http://ftpmaster.internal/ubuntu noble/main amd64 libgcc-s1 amd64 13.2.0-9ubuntu1 [63.1 kB] Get:24 http://ftpmaster.internal/ubuntu noble/main amd64 libgomp1 amd64 13.2.0-9ubuntu1 [142 kB] Get:25 http://ftpmaster.internal/ubuntu noble/main amd64 libitm1 amd64 13.2.0-9ubuntu1 [29.5 kB] Get:26 http://ftpmaster.internal/ubuntu noble/main amd64 libatomic1 amd64 13.2.0-9ubuntu1 [10.5 kB] Get:27 http://ftpmaster.internal/ubuntu noble/main amd64 libasan8 amd64 13.2.0-9ubuntu1 [2835 kB] Get:28 http://ftpmaster.internal/ubuntu noble/main amd64 liblsan0 amd64 13.2.0-9ubuntu1 [1203 kB] Get:29 http://ftpmaster.internal/ubuntu noble/main amd64 libtsan2 amd64 13.2.0-9ubuntu1 [2606 kB] Get:30 http://ftpmaster.internal/ubuntu noble/main amd64 libubsan1 amd64 13.2.0-9ubuntu1 [1105 kB] Get:31 http://ftpmaster.internal/ubuntu noble/main amd64 libhwasan0 amd64 13.2.0-9ubuntu1 [1262 kB] Get:32 http://ftpmaster.internal/ubuntu noble/main amd64 libquadmath0 amd64 13.2.0-9ubuntu1 [153 kB] Get:33 http://ftpmaster.internal/ubuntu noble/main amd64 g++-13 amd64 13.2.0-9ubuntu1 [12.2 MB] Get:34 http://ftpmaster.internal/ubuntu noble/main amd64 libstdc++-13-dev amd64 13.2.0-9ubuntu1 [2336 kB] Get:35 http://ftpmaster.internal/ubuntu noble/main amd64 libgcc-13-dev amd64 13.2.0-9ubuntu1 [2687 kB] Get:36 http://ftpmaster.internal/ubuntu noble/main amd64 gcc-13 amd64 13.2.0-9ubuntu1 [21.5 MB] Get:37 http://ftpmaster.internal/ubuntu noble/main amd64 cpp-13 amd64 13.2.0-9ubuntu1 [10.7 MB] Get:38 http://ftpmaster.internal/ubuntu noble/main amd64 libstdc++6 amd64 13.2.0-9ubuntu1 [771 kB] Get:39 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 zlib1g amd64 1:1.3.dfsg-3ubuntu1 [63.3 kB] Get:40 http://ftpmaster.internal/ubuntu noble/main amd64 libsframe1 amd64 2.41.50.20231214-1ubuntu1 [13.8 kB] Get:41 http://ftpmaster.internal/ubuntu noble/main amd64 libzstd1 amd64 1.5.5+dfsg2-2 [297 kB] Get:42 http://ftpmaster.internal/ubuntu noble/main amd64 libc6 amd64 2.38-3ubuntu1 [3248 kB] Get:43 http://ftpmaster.internal/ubuntu noble/main amd64 base-files amd64 13ubuntu5 [73.6 kB] Get:44 http://ftpmaster.internal/ubuntu noble/main amd64 debianutils amd64 5.14 [89.0 kB] Get:45 http://ftpmaster.internal/ubuntu noble/main amd64 bash amd64 5.2.21-2ubuntu1 [795 kB] Get:46 http://ftpmaster.internal/ubuntu noble/main amd64 bsdutils amd64 1:2.39.2-6ubuntu1 [93.9 kB] Get:47 http://ftpmaster.internal/ubuntu noble/main amd64 coreutils amd64 9.4-2ubuntu1 [1395 kB] Get:48 http://ftpmaster.internal/ubuntu noble/main amd64 diffutils amd64 1:3.10-1 [176 kB] Get:49 http://ftpmaster.internal/ubuntu noble/main amd64 liblzma5 amd64 5.4.5-0.1 [128 kB] Get:50 http://ftpmaster.internal/ubuntu noble/main amd64 libapparmor1 amd64 4.0.0~alpha2-0ubuntu7 [48.2 kB] Get:51 http://ftpmaster.internal/ubuntu noble/main amd64 libaudit-common all 1:3.1.2-1 [5512 B] Get:52 http://ftpmaster.internal/ubuntu noble/main amd64 libcap-ng0 amd64 0.8.3-3 [15.3 kB] Get:53 http://ftpmaster.internal/ubuntu noble/main amd64 libaudit1 amd64 1:3.1.2-1 [46.7 kB] Get:54 http://ftpmaster.internal/ubuntu noble/main amd64 libblkid1 amd64 2.39.2-6ubuntu1 [122 kB] Get:55 http://ftpmaster.internal/ubuntu noble/main amd64 libkmod2 amd64 30+20230601-2ubuntu1 [51.4 kB] Get:56 http://ftpmaster.internal/ubuntu noble/main amd64 libpcre2-8-0 amd64 10.42-4ubuntu1 [228 kB] Get:57 http://ftpmaster.internal/ubuntu noble/main amd64 libselinux1 amd64 3.5-1build2 [78.5 kB] Get:58 http://ftpmaster.internal/ubuntu noble/main amd64 libmount1 amd64 2.39.2-6ubuntu1 [132 kB] Get:59 http://ftpmaster.internal/ubuntu noble/main amd64 libpam0g amd64 1.5.2-9.1ubuntu1 [65.1 kB] Get:60 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libseccomp2 amd64 2.5.4-2ubuntu1 [49.3 kB] Get:61 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 systemd-sysv amd64 255-1ubuntu1 [11.7 kB] Get:62 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 systemd-dev all 255-1ubuntu1 [98.5 kB] Get:63 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 systemd amd64 255-1ubuntu1 [3484 kB] Get:64 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libsystemd-shared amd64 255-1ubuntu1 [2062 kB] Get:65 http://ftpmaster.internal/ubuntu noble/main amd64 libargon2-1 amd64 0~20190702+dfsg-4 [21.4 kB] Get:66 http://ftpmaster.internal/ubuntu noble/main amd64 libuuid1 amd64 2.39.2-6ubuntu1 [34.1 kB] Get:67 http://ftpmaster.internal/ubuntu noble/main amd64 libcryptsetup12 amd64 2:2.6.1-5ubuntu1 [242 kB] Get:68 http://ftpmaster.internal/ubuntu noble/main amd64 libfdisk1 amd64 2.39.2-6ubuntu1 [145 kB] Get:69 http://ftpmaster.internal/ubuntu noble/main amd64 mount amd64 2.39.2-6ubuntu1 [118 kB] Get:70 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libsystemd0 amd64 255-1ubuntu1 [427 kB] Get:71 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libudev1 amd64 255-1ubuntu1 [169 kB] Get:72 http://ftpmaster.internal/ubuntu noble/main amd64 libxxhash0 amd64 0.8.2-2 [25.5 kB] Get:73 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libapt-pkg6.0 amd64 2.7.7 [945 kB] Get:74 http://ftpmaster.internal/ubuntu noble/main amd64 tar amd64 1.34+dfsg-1.2ubuntu2 [293 kB] Get:75 http://ftpmaster.internal/ubuntu noble/main amd64 dpkg amd64 1.22.1ubuntu5 [1387 kB] Get:76 http://ftpmaster.internal/ubuntu noble/main amd64 grep amd64 3.11-3 [161 kB] Get:77 http://ftpmaster.internal/ubuntu noble/main amd64 login amd64 1:4.13+dfsg1-3ubuntu1 [201 kB] Get:78 http://ftpmaster.internal/ubuntu noble/main amd64 ncurses-bin amd64 6.4+20231209-1 [187 kB] Get:79 http://ftpmaster.internal/ubuntu noble/main amd64 libperl5.36 amd64 5.36.0-10ubuntu1 [4782 kB] Get:80 http://ftpmaster.internal/ubuntu noble/main amd64 perl amd64 5.36.0-10ubuntu1 [235 kB] Get:81 http://ftpmaster.internal/ubuntu noble/main amd64 perl-base amd64 5.36.0-10ubuntu1 [1770 kB] Get:82 http://ftpmaster.internal/ubuntu noble/main amd64 perl-modules-5.36 all 5.36.0-10ubuntu1 [2984 kB] Get:83 http://ftpmaster.internal/ubuntu noble/main amd64 libdb5.3 amd64 5.3.28+dfsg2-4 [736 kB] Get:84 http://ftpmaster.internal/ubuntu noble/main amd64 libgdbm6 amd64 1.23-5 [33.3 kB] Get:85 http://ftpmaster.internal/ubuntu noble/main amd64 libgdbm-compat4 amd64 1.23-5 [6498 B] Get:86 http://ftpmaster.internal/ubuntu noble/main amd64 util-linux amd64 2.39.2-6ubuntu1 [1120 kB] Get:87 http://ftpmaster.internal/ubuntu noble/main amd64 libdebconfclient0 amd64 0.271ubuntu1 [11.3 kB] Get:88 http://ftpmaster.internal/ubuntu noble/main amd64 base-passwd amd64 3.6.3 [51.2 kB] Get:89 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 init-system-helpers all 1.66ubuntu1 [39.4 kB] Get:90 http://ftpmaster.internal/ubuntu noble/main amd64 libc-bin amd64 2.38-3ubuntu1 [680 kB] Get:91 http://ftpmaster.internal/ubuntu noble/main amd64 ncurses-base all 6.4+20231209-1 [25.2 kB] Get:92 http://ftpmaster.internal/ubuntu noble/main amd64 sysvinit-utils amd64 3.08-3ubuntu1 [33.7 kB] Get:93 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 apt amd64 2.7.7 [1376 kB] Get:94 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 apt-utils amd64 2.7.7 [216 kB] Get:95 http://ftpmaster.internal/ubuntu noble/main amd64 ubuntu-keyring all 2023.11.28.1 [11.1 kB] Get:96 http://ftpmaster.internal/ubuntu noble/main amd64 libunistring5 amd64 1.1-2 [537 kB] Get:97 http://ftpmaster.internal/ubuntu noble/main amd64 libidn2-0 amd64 2.3.4-1build1 [64.3 kB] Get:98 http://ftpmaster.internal/ubuntu noble/main amd64 libffi8 amd64 3.4.4-2 [24.4 kB] Get:99 http://ftpmaster.internal/ubuntu noble/main amd64 libp11-kit0 amd64 0.25.3-2ubuntu2 [298 kB] Get:100 http://ftpmaster.internal/ubuntu noble/main amd64 libgnutls30 amd64 3.8.1-4ubuntu6 [988 kB] Get:101 http://ftpmaster.internal/ubuntu noble/main amd64 libpam-modules-bin amd64 1.5.2-9.1ubuntu1 [47.6 kB] Get:102 http://ftpmaster.internal/ubuntu noble/main amd64 libpam-modules amd64 1.5.2-9.1ubuntu1 [284 kB] Get:103 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 init amd64 1.66ubuntu1 [6186 B] Get:104 http://ftpmaster.internal/ubuntu noble/main amd64 libsmartcols1 amd64 2.39.2-6ubuntu1 [63.3 kB] Get:105 http://ftpmaster.internal/ubuntu noble/main amd64 uuid-runtime amd64 2.39.2-6ubuntu1 [32.9 kB] Get:106 http://ftpmaster.internal/ubuntu noble/main amd64 libgpg-error-l10n all 1.47-3build1 [8024 B] Get:107 http://ftpmaster.internal/ubuntu noble/main amd64 libgpg-error0 amd64 1.47-3build1 [70.0 kB] Get:108 http://ftpmaster.internal/ubuntu noble/main amd64 libpam-runtime all 1.5.2-9.1ubuntu1 [41.5 kB] Get:109 http://ftpmaster.internal/ubuntu noble/main amd64 libsemanage-common all 3.5-1build1 [9982 B] Get:110 http://ftpmaster.internal/ubuntu noble/main amd64 libsepol2 amd64 3.5-2 [300 kB] Get:111 http://ftpmaster.internal/ubuntu noble/main amd64 libsemanage2 amd64 3.5-1build1 [92.9 kB] Get:112 http://ftpmaster.internal/ubuntu noble/main amd64 libncursesw6 amd64 6.4+20231209-1 [147 kB] Get:113 http://ftpmaster.internal/ubuntu noble/main amd64 libtinfo6 amd64 6.4+20231209-1 [107 kB] Get:114 http://ftpmaster.internal/ubuntu noble/main amd64 passwd amd64 1:4.13+dfsg1-3ubuntu1 [844 kB] Get:115 http://ftpmaster.internal/ubuntu noble/main amd64 libproc2-0 amd64 2:4.0.4-2ubuntu1 [59.0 kB] Get:116 http://ftpmaster.internal/ubuntu noble/main amd64 mawk amd64 1.3.4.20231126-1 [126 kB] Get:117 http://ftpmaster.internal/ubuntu noble/main amd64 procps amd64 2:4.0.4-2ubuntu1 [708 kB] Get:118 http://ftpmaster.internal/ubuntu noble/main amd64 krb5-locales all 1.20.1-5build1 [13.7 kB] Get:119 http://ftpmaster.internal/ubuntu noble/main amd64 readline-common all 8.2-3 [56.2 kB] Get:120 http://ftpmaster.internal/ubuntu noble/main amd64 libreadline8 amd64 8.2-3 [152 kB] Get:121 http://ftpmaster.internal/ubuntu noble/main amd64 libsqlite3-0 amd64 3.44.2-1 [685 kB] Get:122 http://ftpmaster.internal/ubuntu noble/main amd64 openssl amd64 3.0.10-1ubuntu3 [1188 kB] Get:123 http://ftpmaster.internal/ubuntu noble/main amd64 bash-completion all 1:2.11-8 [180 kB] Get:124 http://ftpmaster.internal/ubuntu noble/main amd64 bsdextrautils amd64 2.39.2-6ubuntu1 [73.5 kB] Get:125 http://ftpmaster.internal/ubuntu noble/main amd64 libpng16-16 amd64 1.6.40-2 [186 kB] Get:126 http://ftpmaster.internal/ubuntu noble/main amd64 xz-utils amd64 5.4.5-0.1 [268 kB] Get:127 http://ftpmaster.internal/ubuntu noble/main amd64 g++ amd64 4:13.2.0-2ubuntu1 [1122 B] Get:128 http://ftpmaster.internal/ubuntu noble/main amd64 gcc amd64 4:13.2.0-2ubuntu1 [5166 B] Get:129 http://ftpmaster.internal/ubuntu noble/main amd64 cpp amd64 4:13.2.0-2ubuntu1 [29.0 kB] Get:130 http://ftpmaster.internal/ubuntu noble/main amd64 dpkg-dev all 1.22.1ubuntu5 [1147 kB] Get:131 http://ftpmaster.internal/ubuntu noble/main amd64 libdpkg-perl all 1.22.1ubuntu5 [286 kB] Get:132 http://ftpmaster.internal/ubuntu noble/main amd64 lto-disabled-list all 44 [12.4 kB] Get:133 http://ftpmaster.internal/ubuntu noble/main amd64 libfakeroot amd64 1.32.2-1 [32.1 kB] Get:134 http://ftpmaster.internal/ubuntu noble/main amd64 fakeroot amd64 1.32.2-1 [67.1 kB] Get:135 http://ftpmaster.internal/ubuntu noble/main amd64 optipng amd64 0.7.7-3 [83.3 kB] Get:136 http://ftpmaster.internal/ubuntu noble/main amd64 pinentry-curses amd64 1.2.1-3ubuntu1 [34.9 kB] Preconfiguring packages ... Fetched 111 MB in 2s (68.6 MB/s) (Reading database ... 13648 files and directories currently installed.) Preparing to unpack .../0-libnsl-dev_1.3.0-3_amd64.deb ... Unpacking libnsl-dev:amd64 (1.3.0-3) over (1.3.0-2build2) ... Preparing to unpack .../1-libc6-dev_2.38-3ubuntu1_amd64.deb ... Unpacking libc6-dev:amd64 (2.38-3ubuntu1) over (2.38-1ubuntu6) ... Preparing to unpack .../2-libc-dev-bin_2.38-3ubuntu1_amd64.deb ... Unpacking libc-dev-bin (2.38-3ubuntu1) over (2.38-1ubuntu6) ... Preparing to unpack .../3-libtirpc-common_1.3.4+ds-1_all.deb ... Unpacking libtirpc-common (1.3.4+ds-1) over (1.3.3+ds-1) ... Preparing to unpack .../4-libtirpc-dev_1.3.4+ds-1_amd64.deb ... Unpacking libtirpc-dev:amd64 (1.3.4+ds-1) over (1.3.3+ds-1) ... Preparing to unpack .../5-libgssapi-krb5-2_1.20.1-5build1_amd64.deb ... Unpacking libgssapi-krb5-2:amd64 (1.20.1-5build1) over (1.20.1-3ubuntu1) ... Preparing to unpack .../6-libkrb5-3_1.20.1-5build1_amd64.deb ... Unpacking libkrb5-3:amd64 (1.20.1-5build1) over (1.20.1-3ubuntu1) ... Preparing to unpack .../7-libk5crypto3_1.20.1-5build1_amd64.deb ... Unpacking libk5crypto3:amd64 (1.20.1-5build1) over (1.20.1-3ubuntu1) ... Preparing to unpack .../8-libkrb5support0_1.20.1-5build1_amd64.deb ... Unpacking libkrb5support0:amd64 (1.20.1-5build1) over (1.20.1-3ubuntu1) ... Preparing to unpack .../9-libssl3_3.0.10-1ubuntu3_amd64.deb ... Unpacking libssl3:amd64 (3.0.10-1ubuntu3) over (3.0.10-1ubuntu2) ... Setting up libssl3:amd64 (3.0.10-1ubuntu3) ... (Reading database ... 13648 files and directories currently installed.) Preparing to unpack .../00-libtirpc3_1.3.4+ds-1_amd64.deb ... Unpacking libtirpc3:amd64 (1.3.4+ds-1) over (1.3.3+ds-1) ... Preparing to unpack .../01-libnsl2_1.3.0-3_amd64.deb ... Unpacking libnsl2:amd64 (1.3.0-3) over (1.3.0-2build2) ... Preparing to unpack .../02-linux-libc-dev_6.6.0-14.14_amd64.deb ... Unpacking linux-libc-dev:amd64 (6.6.0-14.14) over (6.5.0-9.9) ... Preparing to unpack .../03-libcc1-0_13.2.0-9ubuntu1_amd64.deb ... Unpacking libcc1-0:amd64 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Preparing to unpack .../04-libgprofng0_2.41.50.20231214-1ubuntu1_amd64.deb ... Unpacking libgprofng0:amd64 (2.41.50.20231214-1ubuntu1) over (2.41-5ubuntu1) ... Preparing to unpack .../05-libctf0_2.41.50.20231214-1ubuntu1_amd64.deb ... Unpacking libctf0:amd64 (2.41.50.20231214-1ubuntu1) over (2.41-5ubuntu1) ... Preparing to unpack .../06-libctf-nobfd0_2.41.50.20231214-1ubuntu1_amd64.deb ... Unpacking libctf-nobfd0:amd64 (2.41.50.20231214-1ubuntu1) over (2.41-5ubuntu1) ... Preparing to unpack .../07-binutils-x86-64-linux-gnu_2.41.50.20231214-1ubuntu1_amd64.deb ... Unpacking binutils-x86-64-linux-gnu (2.41.50.20231214-1ubuntu1) over (2.41-5ubuntu1) ... Preparing to unpack .../08-libbinutils_2.41.50.20231214-1ubuntu1_amd64.deb ... Unpacking libbinutils:amd64 (2.41.50.20231214-1ubuntu1) over (2.41-5ubuntu1) ... Preparing to unpack .../09-binutils-common_2.41.50.20231214-1ubuntu1_amd64.deb ... Unpacking binutils-common:amd64 (2.41.50.20231214-1ubuntu1) over (2.41-5ubuntu1) ... Preparing to unpack .../10-binutils_2.41.50.20231214-1ubuntu1_amd64.deb ... Unpacking binutils (2.41.50.20231214-1ubuntu1) over (2.41-5ubuntu1) ... Preparing to unpack .../11-gcc-13-base_13.2.0-9ubuntu1_amd64.deb ... Unpacking gcc-13-base:amd64 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Setting up gcc-13-base:amd64 (13.2.0-9ubuntu1) ... (Reading database ... 13649 files and directories currently installed.) Preparing to unpack .../libgcc-s1_13.2.0-9ubuntu1_amd64.deb ... Unpacking libgcc-s1:amd64 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Setting up libgcc-s1:amd64 (13.2.0-9ubuntu1) ... (Reading database ... 13649 files and directories currently installed.) Preparing to unpack .../00-libgomp1_13.2.0-9ubuntu1_amd64.deb ... Unpacking libgomp1:amd64 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Preparing to unpack .../01-libitm1_13.2.0-9ubuntu1_amd64.deb ... Unpacking libitm1:amd64 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Preparing to unpack .../02-libatomic1_13.2.0-9ubuntu1_amd64.deb ... Unpacking libatomic1:amd64 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Preparing to unpack .../03-libasan8_13.2.0-9ubuntu1_amd64.deb ... Unpacking libasan8:amd64 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Preparing to unpack .../04-liblsan0_13.2.0-9ubuntu1_amd64.deb ... Unpacking liblsan0:amd64 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Preparing to unpack .../05-libtsan2_13.2.0-9ubuntu1_amd64.deb ... Unpacking libtsan2:amd64 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Preparing to unpack .../06-libubsan1_13.2.0-9ubuntu1_amd64.deb ... Unpacking libubsan1:amd64 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Preparing to unpack .../07-libhwasan0_13.2.0-9ubuntu1_amd64.deb ... Unpacking libhwasan0:amd64 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Preparing to unpack .../08-libquadmath0_13.2.0-9ubuntu1_amd64.deb ... Unpacking libquadmath0:amd64 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Preparing to unpack .../09-g++-13_13.2.0-9ubuntu1_amd64.deb ... Unpacking g++-13 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Preparing to unpack .../10-libstdc++-13-dev_13.2.0-9ubuntu1_amd64.deb ... Unpacking libstdc++-13-dev:amd64 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Preparing to unpack .../11-libgcc-13-dev_13.2.0-9ubuntu1_amd64.deb ... Unpacking libgcc-13-dev:amd64 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Preparing to unpack .../12-gcc-13_13.2.0-9ubuntu1_amd64.deb ... Unpacking gcc-13 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Preparing to unpack .../13-cpp-13_13.2.0-9ubuntu1_amd64.deb ... Unpacking cpp-13 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Preparing to unpack .../14-libstdc++6_13.2.0-9ubuntu1_amd64.deb ... Unpacking libstdc++6:amd64 (13.2.0-9ubuntu1) over (13.2.0-4ubuntu3) ... Setting up libstdc++6:amd64 (13.2.0-9ubuntu1) ... (Reading database ... 13647 files and directories currently installed.) Preparing to unpack .../zlib1g_1%3a1.3.dfsg-3ubuntu1_amd64.deb ... Unpacking zlib1g:amd64 (1:1.3.dfsg-3ubuntu1) over (1:1.2.13.dfsg-1ubuntu5) ... Setting up zlib1g:amd64 (1:1.3.dfsg-3ubuntu1) ... (Reading database ... 13647 files and directories currently installed.) Preparing to unpack .../libsframe1_2.41.50.20231214-1ubuntu1_amd64.deb ... Unpacking libsframe1:amd64 (2.41.50.20231214-1ubuntu1) over (2.41-5ubuntu1) ... Preparing to unpack .../libzstd1_1.5.5+dfsg2-2_amd64.deb ... Unpacking libzstd1:amd64 (1.5.5+dfsg2-2) over (1.5.5+dfsg2-1ubuntu2) ... Setting up libzstd1:amd64 (1.5.5+dfsg2-2) ... (Reading database ... 13647 files and directories currently installed.) Preparing to unpack .../libc6_2.38-3ubuntu1_amd64.deb ... Unpacking libc6:amd64 (2.38-3ubuntu1) over (2.38-1ubuntu6) ... Setting up libc6:amd64 (2.38-3ubuntu1) ... (Reading database ... 13647 files and directories currently installed.) Preparing to unpack .../base-files_13ubuntu5_amd64.deb ... Unpacking base-files (13ubuntu5) over (13ubuntu3) ... Setting up base-files (13ubuntu5) ... Installing new version of config file /etc/issue ... Installing new version of config file /etc/issue.net ... Installing new version of config file /etc/lsb-release ... (Reading database ... 13647 files and directories currently installed.) Preparing to unpack .../debianutils_5.14_amd64.deb ... Unpacking debianutils (5.14) over (5.8-1) ... Setting up debianutils (5.14) ... (Reading database ... 13646 files and directories currently installed.) Preparing to unpack .../bash_5.2.21-2ubuntu1_amd64.deb ... Unpacking bash (5.2.21-2ubuntu1) over (5.2.15-2ubuntu1) ... Setting up bash (5.2.21-2ubuntu1) ... update-alternatives: using /usr/share/man/man7/bash-builtins.7.gz to provide /usr/share/man/man7/builtins.7.gz (builtins.7.gz) in auto mode (Reading database ... 13646 files and directories currently installed.) Preparing to unpack .../bsdutils_1%3a2.39.2-6ubuntu1_amd64.deb ... Unpacking bsdutils (1:2.39.2-6ubuntu1) over (1:2.39.1-4ubuntu2) ... Setting up bsdutils (1:2.39.2-6ubuntu1) ... (Reading database ... 13646 files and directories currently installed.) Preparing to unpack .../coreutils_9.4-2ubuntu1_amd64.deb ... Unpacking coreutils (9.4-2ubuntu1) over (9.1-1ubuntu2) ... Setting up coreutils (9.4-2ubuntu1) ... (Reading database ... 13651 files and directories currently installed.) Preparing to unpack .../diffutils_1%3a3.10-1_amd64.deb ... Unpacking diffutils (1:3.10-1) over (1:3.8-4) ... Setting up diffutils (1:3.10-1) ... (Reading database ... 13651 files and directories currently installed.) Preparing to unpack .../liblzma5_5.4.5-0.1_amd64.deb ... Unpacking liblzma5:amd64 (5.4.5-0.1) over (5.4.1-0.2) ... Setting up liblzma5:amd64 (5.4.5-0.1) ... (Reading database ... 13651 files and directories currently installed.) Preparing to unpack .../libapparmor1_4.0.0~alpha2-0ubuntu7_amd64.deb ... Unpacking libapparmor1:amd64 (4.0.0~alpha2-0ubuntu7) over (4.0.0~alpha2-0ubuntu5) ... Preparing to unpack .../libaudit-common_1%3a3.1.2-1_all.deb ... Unpacking libaudit-common (1:3.1.2-1) over (1:3.1.1-1) ... Setting up libaudit-common (1:3.1.2-1) ... (Reading database ... 13651 files and directories currently installed.) Preparing to unpack .../libcap-ng0_0.8.3-3_amd64.deb ... Unpacking libcap-ng0:amd64 (0.8.3-3) over (0.8.3-1build2) ... Setting up libcap-ng0:amd64 (0.8.3-3) ... (Reading database ... 13651 files and directories currently installed.) Preparing to unpack .../libaudit1_1%3a3.1.2-1_amd64.deb ... Unpacking libaudit1:amd64 (1:3.1.2-1) over (1:3.1.1-1) ... Setting up libaudit1:amd64 (1:3.1.2-1) ... (Reading database ... 13651 files and directories currently installed.) Preparing to unpack .../libblkid1_2.39.2-6ubuntu1_amd64.deb ... Unpacking libblkid1:amd64 (2.39.2-6ubuntu1) over (2.39.1-4ubuntu2) ... Setting up libblkid1:amd64 (2.39.2-6ubuntu1) ... (Reading database ... 13651 files and directories currently installed.) Preparing to unpack .../libkmod2_30+20230601-2ubuntu1_amd64.deb ... Unpacking libkmod2:amd64 (30+20230601-2ubuntu1) over (30+20230519-1ubuntu3) ... Preparing to unpack .../libpcre2-8-0_10.42-4ubuntu1_amd64.deb ... Unpacking libpcre2-8-0:amd64 (10.42-4ubuntu1) over (10.42-4) ... Setting up libpcre2-8-0:amd64 (10.42-4ubuntu1) ... (Reading database ... 13651 files and directories currently installed.) Preparing to unpack .../libselinux1_3.5-1build2_amd64.deb ... Unpacking libselinux1:amd64 (3.5-1build2) over (3.5-1) ... Setting up libselinux1:amd64 (3.5-1build2) ... (Reading database ... 13651 files and directories currently installed.) Preparing to unpack .../libmount1_2.39.2-6ubuntu1_amd64.deb ... Unpacking libmount1:amd64 (2.39.2-6ubuntu1) over (2.39.1-4ubuntu2) ... Setting up libmount1:amd64 (2.39.2-6ubuntu1) ... (Reading database ... 13651 files and directories currently installed.) Preparing to unpack .../libpam0g_1.5.2-9.1ubuntu1_amd64.deb ... Unpacking libpam0g:amd64 (1.5.2-9.1ubuntu1) over (1.5.2-6ubuntu1) ... Setting up libpam0g:amd64 (1.5.2-9.1ubuntu1) ... (Reading database ... 13650 files and directories currently installed.) Preparing to unpack .../libseccomp2_2.5.4-2ubuntu1_amd64.deb ... Unpacking libseccomp2:amd64 (2.5.4-2ubuntu1) over (2.5.4-1ubuntu3) ... Setting up libseccomp2:amd64 (2.5.4-2ubuntu1) ... (Reading database ... 13650 files and directories currently installed.) Preparing to unpack .../0-systemd-sysv_255-1ubuntu1_amd64.deb ... Unpacking systemd-sysv (255-1ubuntu1) over (253.5-1ubuntu6) ... Preparing to unpack .../1-systemd-dev_255-1ubuntu1_all.deb ... Unpacking systemd-dev (255-1ubuntu1) over (253.5-1ubuntu6) ... Preparing to unpack .../2-systemd_255-1ubuntu1_amd64.deb ... Unpacking systemd (255-1ubuntu1) over (253.5-1ubuntu6) ... dpkg: warning: unable to delete old directory '/lib/systemd/system-preset': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/system-generators': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/system/user@0.service.d': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/system/user@.service.d': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/system/user-.slice.d': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/system/timers.target.wants': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/system/systemd-localed.service.d': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/system/sysinit.target.wants': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/system/sockets.target.wants': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/system/rescue.target.wants': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/system/rc-local.service.d': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/system/multi-user.target.wants': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/system/initrd.target.wants': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/system/initrd-root-fs.target.wants': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/system/initrd-root-device.target.wants': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/system/graphical.target.wants': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/system/getty.target.wants': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/network': Directory not empty dpkg: warning: unable to delete old directory '/lib/systemd/journald.conf.d': Directory not empty dpkg: warning: unable to delete old directory '/lib/modprobe.d': Directory not empty Preparing to unpack .../3-libsystemd-shared_255-1ubuntu1_amd64.deb ... Unpacking libsystemd-shared:amd64 (255-1ubuntu1) over (253.5-1ubuntu6) ... Preparing to unpack .../4-libargon2-1_0~20190702+dfsg-4_amd64.deb ... Unpacking libargon2-1:amd64 (0~20190702+dfsg-4) over (0~20190702+dfsg-3) ... Preparing to unpack .../5-libuuid1_2.39.2-6ubuntu1_amd64.deb ... Unpacking libuuid1:amd64 (2.39.2-6ubuntu1) over (2.39.1-4ubuntu2) ... Setting up libuuid1:amd64 (2.39.2-6ubuntu1) ... (Reading database ... 13813 files and directories currently installed.) Preparing to unpack .../libcryptsetup12_2%3a2.6.1-5ubuntu1_amd64.deb ... Unpacking libcryptsetup12:amd64 (2:2.6.1-5ubuntu1) over (2:2.6.1-4ubuntu3) ... Preparing to unpack .../libfdisk1_2.39.2-6ubuntu1_amd64.deb ... Unpacking libfdisk1:amd64 (2.39.2-6ubuntu1) over (2.39.1-4ubuntu2) ... Preparing to unpack .../mount_2.39.2-6ubuntu1_amd64.deb ... Unpacking mount (2.39.2-6ubuntu1) over (2.39.1-4ubuntu2) ... Preparing to unpack .../libsystemd0_255-1ubuntu1_amd64.deb ... Unpacking libsystemd0:amd64 (255-1ubuntu1) over (253.5-1ubuntu6) ... Setting up libsystemd0:amd64 (255-1ubuntu1) ... (Reading database ... 13813 files and directories currently installed.) Preparing to unpack .../libudev1_255-1ubuntu1_amd64.deb ... Unpacking libudev1:amd64 (255-1ubuntu1) over (253.5-1ubuntu6) ... Setting up libudev1:amd64 (255-1ubuntu1) ... (Reading database ... 13813 files and directories currently installed.) Preparing to unpack .../libxxhash0_0.8.2-2_amd64.deb ... Unpacking libxxhash0:amd64 (0.8.2-2) over (0.8.1-1) ... Setting up libxxhash0:amd64 (0.8.2-2) ... (Reading database ... 13813 files and directories currently installed.) Preparing to unpack .../libapt-pkg6.0_2.7.7_amd64.deb ... Unpacking libapt-pkg6.0:amd64 (2.7.7) over (2.7.3) ... Setting up libapt-pkg6.0:amd64 (2.7.7) ... (Reading database ... 13813 files and directories currently installed.) Preparing to unpack .../tar_1.34+dfsg-1.2ubuntu2_amd64.deb ... Unpacking tar (1.34+dfsg-1.2ubuntu2) over (1.34+dfsg-1.2ubuntu1) ... Setting up tar (1.34+dfsg-1.2ubuntu2) ... (Reading database ... 13813 files and directories currently installed.) Preparing to unpack .../dpkg_1.22.1ubuntu5_amd64.deb ... Unpacking dpkg (1.22.1ubuntu5) over (1.22.0ubuntu1) ... Setting up dpkg (1.22.1ubuntu5) ... (Reading database ... 13811 files and directories currently installed.) Preparing to unpack .../archives/grep_3.11-3_amd64.deb ... Unpacking grep (3.11-3) over (3.11-2) ... Setting up grep (3.11-3) ... (Reading database ... 13811 files and directories currently installed.) Preparing to unpack .../login_1%3a4.13+dfsg1-3ubuntu1_amd64.deb ... Unpacking login (1:4.13+dfsg1-3ubuntu1) over (1:4.13+dfsg1-1ubuntu1) ... Setting up login (1:4.13+dfsg1-3ubuntu1) ... Installing new version of config file /etc/login.defs ... Installing new version of config file /etc/pam.d/login ... (Reading database ... 13811 files and directories currently installed.) Preparing to unpack .../ncurses-bin_6.4+20231209-1_amd64.deb ... Unpacking ncurses-bin (6.4+20231209-1) over (6.4+20230625-2) ... Setting up ncurses-bin (6.4+20231209-1) ... (Reading database ... 13811 files and directories currently installed.) Preparing to unpack .../libperl5.36_5.36.0-10ubuntu1_amd64.deb ... Unpacking libperl5.36:amd64 (5.36.0-10ubuntu1) over (5.36.0-9ubuntu1) ... Preparing to unpack .../perl_5.36.0-10ubuntu1_amd64.deb ... Unpacking perl (5.36.0-10ubuntu1) over (5.36.0-9ubuntu1) ... Preparing to unpack .../perl-base_5.36.0-10ubuntu1_amd64.deb ... Unpacking perl-base (5.36.0-10ubuntu1) over (5.36.0-9ubuntu1) ... Setting up perl-base (5.36.0-10ubuntu1) ... (Reading database ... 13811 files and directories currently installed.) Preparing to unpack .../perl-modules-5.36_5.36.0-10ubuntu1_all.deb ... Unpacking perl-modules-5.36 (5.36.0-10ubuntu1) over (5.36.0-9ubuntu1) ... Preparing to unpack .../libdb5.3_5.3.28+dfsg2-4_amd64.deb ... Unpacking libdb5.3:amd64 (5.3.28+dfsg2-4) over (5.3.28+dfsg2-2) ... Setting up libdb5.3:amd64 (5.3.28+dfsg2-4) ... (Reading database ... 13811 files and directories currently installed.) Preparing to unpack .../libgdbm6_1.23-5_amd64.deb ... Unpacking libgdbm6:amd64 (1.23-5) over (1.23-3) ... Preparing to unpack .../libgdbm-compat4_1.23-5_amd64.deb ... Unpacking libgdbm-compat4:amd64 (1.23-5) over (1.23-3) ... Preparing to unpack .../util-linux_2.39.2-6ubuntu1_amd64.deb ... Unpacking util-linux (2.39.2-6ubuntu1) over (2.39.1-4ubuntu2) ... Setting up util-linux (2.39.2-6ubuntu1) ... (Reading database ... 13812 files and directories currently installed.) Preparing to unpack .../libdebconfclient0_0.271ubuntu1_amd64.deb ... Unpacking libdebconfclient0:amd64 (0.271ubuntu1) over (0.270ubuntu1) ... Setting up libdebconfclient0:amd64 (0.271ubuntu1) ... (Reading database ... 13812 files and directories currently installed.) Preparing to unpack .../base-passwd_3.6.3_amd64.deb ... Unpacking base-passwd (3.6.3) over (3.6.1) ... Setting up base-passwd (3.6.3) ... (Reading database ... 13812 files and directories currently installed.) Preparing to unpack .../init-system-helpers_1.66ubuntu1_all.deb ... Unpacking init-system-helpers (1.66ubuntu1) over (1.65.2ubuntu1) ... Setting up init-system-helpers (1.66ubuntu1) ... (Reading database ... 13812 files and directories currently installed.) Preparing to unpack .../libc-bin_2.38-3ubuntu1_amd64.deb ... Unpacking libc-bin (2.38-3ubuntu1) over (2.38-1ubuntu6) ... Setting up libc-bin (2.38-3ubuntu1) ... (Reading database ... 13812 files and directories currently installed.) Preparing to unpack .../ncurses-base_6.4+20231209-1_all.deb ... Unpacking ncurses-base (6.4+20231209-1) over (6.4+20230625-2) ... Setting up ncurses-base (6.4+20231209-1) ... (Reading database ... 13812 files and directories currently installed.) Preparing to unpack .../sysvinit-utils_3.08-3ubuntu1_amd64.deb ... Unpacking sysvinit-utils (3.08-3ubuntu1) over (3.07-1ubuntu1) ... Setting up sysvinit-utils (3.08-3ubuntu1) ... (Reading database ... 13812 files and directories currently installed.) Preparing to unpack .../archives/apt_2.7.7_amd64.deb ... Unpacking apt (2.7.7) over (2.7.3) ... Setting up apt (2.7.7) ... (Reading database ... 13812 files and directories currently installed.) Preparing to unpack .../apt-utils_2.7.7_amd64.deb ... Unpacking apt-utils (2.7.7) over (2.7.3) ... Preparing to unpack .../ubuntu-keyring_2023.11.28.1_all.deb ... Unpacking ubuntu-keyring (2023.11.28.1) over (2021.03.26) ... Setting up ubuntu-keyring (2023.11.28.1) ... Selecting previously unselected package libunistring5:amd64. (Reading database ... 13812 files and directories currently installed.) Preparing to unpack .../libunistring5_1.1-2_amd64.deb ... Unpacking libunistring5:amd64 (1.1-2) ... Setting up libunistring5:amd64 (1.1-2) ... (Reading database ... 13817 files and directories currently installed.) Preparing to unpack .../libidn2-0_2.3.4-1build1_amd64.deb ... Unpacking libidn2-0:amd64 (2.3.4-1build1) over (2.3.4-1) ... Setting up libidn2-0:amd64 (2.3.4-1build1) ... (Reading database ... 13817 files and directories currently installed.) Preparing to unpack .../libffi8_3.4.4-2_amd64.deb ... Unpacking libffi8:amd64 (3.4.4-2) over (3.4.4-1) ... Setting up libffi8:amd64 (3.4.4-2) ... (Reading database ... 13817 files and directories currently installed.) Preparing to unpack .../libp11-kit0_0.25.3-2ubuntu2_amd64.deb ... Unpacking libp11-kit0:amd64 (0.25.3-2ubuntu2) over (0.25.0-4ubuntu1) ... Setting up libp11-kit0:amd64 (0.25.3-2ubuntu2) ... (Reading database ... 13817 files and directories currently installed.) Preparing to unpack .../libgnutls30_3.8.1-4ubuntu6_amd64.deb ... Unpacking libgnutls30:amd64 (3.8.1-4ubuntu6) over (3.8.1-4ubuntu1) ... Setting up libgnutls30:amd64 (3.8.1-4ubuntu6) ... (Reading database ... 13818 files and directories currently installed.) Preparing to unpack .../libpam-modules-bin_1.5.2-9.1ubuntu1_amd64.deb ... Unpacking libpam-modules-bin (1.5.2-9.1ubuntu1) over (1.5.2-6ubuntu1) ... Setting up libpam-modules-bin (1.5.2-9.1ubuntu1) ... (Reading database ... 13817 files and directories currently installed.) Preparing to unpack .../libpam-modules_1.5.2-9.1ubuntu1_amd64.deb ... Unpacking libpam-modules:amd64 (1.5.2-9.1ubuntu1) over (1.5.2-6ubuntu1) ... Setting up libpam-modules:amd64 (1.5.2-9.1ubuntu1) ... Setting up libapparmor1:amd64 (4.0.0~alpha2-0ubuntu7) ... Setting up libargon2-1:amd64 (0~20190702+dfsg-4) ... Setting up libcryptsetup12:amd64 (2:2.6.1-5ubuntu1) ... Setting up libfdisk1:amd64 (2.39.2-6ubuntu1) ... Setting up libkmod2:amd64 (30+20230601-2ubuntu1) ... Setting up libsystemd-shared:amd64 (255-1ubuntu1) ... Setting up systemd-dev (255-1ubuntu1) ... Setting up mount (2.39.2-6ubuntu1) ... Setting up systemd (255-1ubuntu1) ... Installing new version of config file /etc/systemd/journald.conf ... Installing new version of config file /etc/systemd/logind.conf ... Installing new version of config file /etc/systemd/networkd.conf ... Installing new version of config file /etc/systemd/pstore.conf ... Installing new version of config file /etc/systemd/sleep.conf ... Installing new version of config file /etc/systemd/system.conf ... Installing new version of config file /etc/systemd/user.conf ... Initializing machine ID from random generator. Setting up systemd-sysv (255-1ubuntu1) ... (Reading database ... 13816 files and directories currently installed.) Preparing to unpack .../init_1.66ubuntu1_amd64.deb ... Unpacking init (1.66ubuntu1) over (1.65.2ubuntu1) ... Preparing to unpack .../libsmartcols1_2.39.2-6ubuntu1_amd64.deb ... Unpacking libsmartcols1:amd64 (2.39.2-6ubuntu1) over (2.39.1-4ubuntu2) ... Setting up libsmartcols1:amd64 (2.39.2-6ubuntu1) ... (Reading database ... 13817 files and directories currently installed.) Preparing to unpack .../uuid-runtime_2.39.2-6ubuntu1_amd64.deb ... Unpacking uuid-runtime (2.39.2-6ubuntu1) over (2.39.1-4ubuntu2) ... Preparing to unpack .../libgpg-error-l10n_1.47-3build1_all.deb ... Unpacking libgpg-error-l10n (1.47-3build1) over (1.47-2) ... Preparing to unpack .../libgpg-error0_1.47-3build1_amd64.deb ... Unpacking libgpg-error0:amd64 (1.47-3build1) over (1.47-2) ... Setting up libgpg-error0:amd64 (1.47-3build1) ... (Reading database ... 13817 files and directories currently installed.) Preparing to unpack .../libpam-runtime_1.5.2-9.1ubuntu1_all.deb ... Unpacking libpam-runtime (1.5.2-9.1ubuntu1) over (1.5.2-6ubuntu1) ... Setting up libpam-runtime (1.5.2-9.1ubuntu1) ... (Reading database ... 13816 files and directories currently installed.) Preparing to unpack .../libsemanage-common_3.5-1build1_all.deb ... Unpacking libsemanage-common (3.5-1build1) over (3.5-1) ... Setting up libsemanage-common (3.5-1build1) ... (Reading database ... 13816 files and directories currently installed.) Preparing to unpack .../libsepol2_3.5-2_amd64.deb ... Unpacking libsepol2:amd64 (3.5-2) over (3.5-1) ... Setting up libsepol2:amd64 (3.5-2) ... (Reading database ... 13816 files and directories currently installed.) Preparing to unpack .../libsemanage2_3.5-1build1_amd64.deb ... Unpacking libsemanage2:amd64 (3.5-1build1) over (3.5-1) ... Setting up libsemanage2:amd64 (3.5-1build1) ... (Reading database ... 13816 files and directories currently installed.) Preparing to unpack .../libncursesw6_6.4+20231209-1_amd64.deb ... Unpacking libncursesw6:amd64 (6.4+20231209-1) over (6.4+20230625-2) ... Preparing to unpack .../libtinfo6_6.4+20231209-1_amd64.deb ... Unpacking libtinfo6:amd64 (6.4+20231209-1) over (6.4+20230625-2) ... Setting up libtinfo6:amd64 (6.4+20231209-1) ... (Reading database ... 13816 files and directories currently installed.) Preparing to unpack .../passwd_1%3a4.13+dfsg1-3ubuntu1_amd64.deb ... Unpacking passwd (1:4.13+dfsg1-3ubuntu1) over (1:4.13+dfsg1-1ubuntu1) ... Setting up passwd (1:4.13+dfsg1-3ubuntu1) ... (Reading database ... 13816 files and directories currently installed.) Preparing to unpack .../00-libproc2-0_2%3a4.0.4-2ubuntu1_amd64.deb ... Unpacking libproc2-0:amd64 (2:4.0.4-2ubuntu1) over (2:4.0.3-1ubuntu1) ... Preparing to unpack .../01-mawk_1.3.4.20231126-1_amd64.deb ... Unpacking mawk (1.3.4.20231126-1) over (1.3.4.20230730-1) ... Preparing to unpack .../02-procps_2%3a4.0.4-2ubuntu1_amd64.deb ... Unpacking procps (2:4.0.4-2ubuntu1) over (2:4.0.3-1ubuntu1) ... Preparing to unpack .../03-krb5-locales_1.20.1-5build1_all.deb ... Unpacking krb5-locales (1.20.1-5build1) over (1.20.1-3ubuntu1) ... Preparing to unpack .../04-readline-common_8.2-3_all.deb ... Unpacking readline-common (8.2-3) over (8.2-1.3) ... Preparing to unpack .../05-libreadline8_8.2-3_amd64.deb ... Unpacking libreadline8:amd64 (8.2-3) over (8.2-1.3) ... Preparing to unpack .../06-libsqlite3-0_3.44.2-1_amd64.deb ... Unpacking libsqlite3-0:amd64 (3.44.2-1) over (3.42.0-1) ... Preparing to unpack .../07-openssl_3.0.10-1ubuntu3_amd64.deb ... Unpacking openssl (3.0.10-1ubuntu3) over (3.0.10-1ubuntu2) ... Preparing to unpack .../08-bash-completion_1%3a2.11-8_all.deb ... Unpacking bash-completion (1:2.11-8) over (1:2.11-7) ... Preparing to unpack .../09-bsdextrautils_2.39.2-6ubuntu1_amd64.deb ... Unpacking bsdextrautils (2.39.2-6ubuntu1) over (2.39.1-4ubuntu2) ... Preparing to unpack .../10-libpng16-16_1.6.40-2_amd64.deb ... Unpacking libpng16-16:amd64 (1.6.40-2) over (1.6.40-1) ... Preparing to unpack .../11-xz-utils_5.4.5-0.1_amd64.deb ... Unpacking xz-utils (5.4.5-0.1) over (5.4.1-0.2) ... Preparing to unpack .../12-g++_4%3a13.2.0-2ubuntu1_amd64.deb ... Unpacking g++ (4:13.2.0-2ubuntu1) over (4:13.2.0-1ubuntu1) ... Preparing to unpack .../13-gcc_4%3a13.2.0-2ubuntu1_amd64.deb ... Unpacking gcc (4:13.2.0-2ubuntu1) over (4:13.2.0-1ubuntu1) ... Preparing to unpack .../14-cpp_4%3a13.2.0-2ubuntu1_amd64.deb ... Unpacking cpp (4:13.2.0-2ubuntu1) over (4:13.2.0-1ubuntu1) ... Preparing to unpack .../15-dpkg-dev_1.22.1ubuntu5_all.deb ... Unpacking dpkg-dev (1.22.1ubuntu5) over (1.22.0ubuntu1) ... Preparing to unpack .../16-libdpkg-perl_1.22.1ubuntu5_all.deb ... Unpacking libdpkg-perl (1.22.1ubuntu5) over (1.22.0ubuntu1) ... Preparing to unpack .../17-lto-disabled-list_44_all.deb ... Unpacking lto-disabled-list (44) over (43) ... Preparing to unpack .../18-libfakeroot_1.32.2-1_amd64.deb ... Unpacking libfakeroot:amd64 (1.32.2-1) over (1.32.1-1) ... Preparing to unpack .../19-fakeroot_1.32.2-1_amd64.deb ... Unpacking fakeroot (1.32.2-1) over (1.32.1-1) ... Preparing to unpack .../20-optipng_0.7.7-3_amd64.deb ... Unpacking optipng (0.7.7-3) over (0.7.7-2build1) ... Preparing to unpack .../21-pinentry-curses_1.2.1-3ubuntu1_amd64.deb ... Unpacking pinentry-curses (1.2.1-3ubuntu1) over (1.2.1-1ubuntu1) ... Setting up lto-disabled-list (44) ... Setting up apt-utils (2.7.7) ... Setting up bsdextrautils (2.39.2-6ubuntu1) ... Setting up cpp-13 (13.2.0-9ubuntu1) ... Setting up init (1.66ubuntu1) ... Setting up libtirpc-common (1.3.4+ds-1) ... Setting up libsqlite3-0:amd64 (3.44.2-1) ... Setting up binutils-common:amd64 (2.41.50.20231214-1ubuntu1) ... Installing new version of config file /etc/gprofng.rc ... Setting up linux-libc-dev:amd64 (6.6.0-14.14) ... Setting up libctf-nobfd0:amd64 (2.41.50.20231214-1ubuntu1) ... Setting up krb5-locales (1.20.1-5build1) ... Setting up libgomp1:amd64 (13.2.0-9ubuntu1) ... Setting up libsframe1:amd64 (2.41.50.20231214-1ubuntu1) ... Setting up libfakeroot:amd64 (1.32.2-1) ... Setting up libkrb5support0:amd64 (1.20.1-5build1) ... Setting up fakeroot (1.32.2-1) ... Setting up perl-modules-5.36 (5.36.0-10ubuntu1) ... Setting up bash-completion (1:2.11-8) ... Setting up xz-utils (5.4.5-0.1) ... Setting up libquadmath0:amd64 (13.2.0-9ubuntu1) ... Setting up libproc2-0:amd64 (2:4.0.4-2ubuntu1) ... Setting up libpng16-16:amd64 (1.6.40-2) ... Setting up libatomic1:amd64 (13.2.0-9ubuntu1) ... Setting up libncursesw6:amd64 (6.4+20231209-1) ... Setting up libk5crypto3:amd64 (1.20.1-5build1) ... Setting up libubsan1:amd64 (13.2.0-9ubuntu1) ... Setting up uuid-runtime (2.39.2-6ubuntu1) ... Running in chroot, ignoring request. invoke-rc.d: policy-rc.d denied execution of restart. Setting up libhwasan0:amd64 (13.2.0-9ubuntu1) ... Setting up cpp (4:13.2.0-2ubuntu1) ... Setting up libasan8:amd64 (13.2.0-9ubuntu1) ... Setting up procps (2:4.0.4-2ubuntu1) ... Installing new version of config file /etc/sysctl.conf ... Setting up mawk (1.3.4.20231126-1) ... Setting up libkrb5-3:amd64 (1.20.1-5build1) ... Setting up libtsan2:amd64 (13.2.0-9ubuntu1) ... Setting up libbinutils:amd64 (2.41.50.20231214-1ubuntu1) ... Setting up libc-dev-bin (2.38-3ubuntu1) ... Setting up openssl (3.0.10-1ubuntu3) ... Setting up libgpg-error-l10n (1.47-3build1) ... Setting up readline-common (8.2-3) ... Setting up libcc1-0:amd64 (13.2.0-9ubuntu1) ... Setting up liblsan0:amd64 (13.2.0-9ubuntu1) ... Setting up libitm1:amd64 (13.2.0-9ubuntu1) ... Setting up libgdbm6:amd64 (1.23-5) ... Setting up libctf0:amd64 (2.41.50.20231214-1ubuntu1) ... Setting up pinentry-curses (1.2.1-3ubuntu1) ... Setting up libreadline8:amd64 (8.2-3) ... Setting up libgprofng0:amd64 (2.41.50.20231214-1ubuntu1) ... Setting up optipng (0.7.7-3) ... Setting up libgssapi-krb5-2:amd64 (1.20.1-5build1) ... Setting up libgdbm-compat4:amd64 (1.23-5) ... Setting up libgcc-13-dev:amd64 (13.2.0-9ubuntu1) ... Setting up libperl5.36:amd64 (5.36.0-10ubuntu1) ... Setting up binutils-x86-64-linux-gnu (2.41.50.20231214-1ubuntu1) ... Setting up libtirpc3:amd64 (1.3.4+ds-1) ... Setting up binutils (2.41.50.20231214-1ubuntu1) ... Setting up perl (5.36.0-10ubuntu1) ... Setting up libtirpc-dev:amd64 (1.3.4+ds-1) ... Setting up gcc-13 (13.2.0-9ubuntu1) ... Setting up libdpkg-perl (1.22.1ubuntu5) ... Setting up libnsl2:amd64 (1.3.0-3) ... Setting up gcc (4:13.2.0-2ubuntu1) ... Setting up dpkg-dev (1.22.1ubuntu5) ... Setting up libnsl-dev:amd64 (1.3.0-3) ... Setting up libc6-dev:amd64 (2.38-3ubuntu1) ... Setting up libstdc++-13-dev:amd64 (13.2.0-9ubuntu1) ... Setting up g++-13 (13.2.0-9ubuntu1) ... Setting up g++ (4:13.2.0-2ubuntu1) ... Processing triggers for libc-bin (2.38-3ubuntu1) ... Processing triggers for debianutils (5.14) ... RUN: /usr/share/launchpad-buildd/bin/sbuild-package PACKAGEBUILD-27576134 amd64 noble-proposed -c chroot:build-PACKAGEBUILD-27576134 --arch=amd64 --dist=noble-proposed --nolog -A ataqv_1.3.1+ds-2build1.dsc Initiating build PACKAGEBUILD-27576134 with 4 jobs across 4 processor cores. Kernel reported to sbuild: 5.4.0-169-generic #187-Ubuntu SMP Thu Nov 23 14:52:28 UTC 2023 x86_64 sbuild (Debian sbuild) 0.79.0 (05 February 2020) on lcy02-amd64-063.buildd +==============================================================================+ | ataqv 1.3.1+ds-2build1 (amd64) Tue, 19 Dec 2023 15:07:56 +0000 | +==============================================================================+ Package: ataqv Version: 1.3.1+ds-2build1 Source Version: 1.3.1+ds-2build1 Distribution: noble-proposed Machine Architecture: amd64 Host Architecture: amd64 Build Architecture: amd64 Build Type: binary I: NOTICE: Log filtering will replace 'home/buildd/build-PACKAGEBUILD-27576134/chroot-autobuild' with '<>' I: NOTICE: Log filtering will replace 'build/ataqv-KDnHRb/resolver-yGFsvQ' with '<>' +------------------------------------------------------------------------------+ | Fetch source files | +------------------------------------------------------------------------------+ Local sources ------------- ataqv_1.3.1+ds-2build1.dsc exists in .; copying to chroot I: NOTICE: Log filtering will replace 'build/ataqv-KDnHRb/ataqv-1.3.1+ds' with '<>' I: NOTICE: Log filtering will replace 'build/ataqv-KDnHRb' with '<>' +------------------------------------------------------------------------------+ | Install package build dependencies | +------------------------------------------------------------------------------+ Setup apt archive ----------------- Merged Build-Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3, debhelper, build-essential, fakeroot Filtered Build-Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3, debhelper, build-essential, fakeroot dpkg-deb: building package 'sbuild-build-depends-main-dummy' in '/<>/apt_archive/sbuild-build-depends-main-dummy.deb'. Ign:1 copy:/<>/apt_archive ./ InRelease Get:2 copy:/<>/apt_archive ./ Release [957 B] Ign:3 copy:/<>/apt_archive ./ Release.gpg Get:4 copy:/<>/apt_archive ./ Sources [492 B] Get:5 copy:/<>/apt_archive ./ Packages [570 B] Fetched 2019 B in 0s (0 B/s) Reading package lists... Reading package lists... Install main build dependencies (apt-based resolver) ---------------------------------------------------- Installing build dependencies Reading package lists... Building dependency tree... Reading state information... The following packages were automatically installed and are no longer required: apt-utils bash-completion ca-certificates debconf-i18n krb5-locales libgpg-error-l10n libgpm2 libip4tc2 libnss-nis libnss-nisplus libtext-charwidth-perl libtext-iconv-perl libtext-wrapi18n-perl libunistring2 openssl psmisc uuid-runtime Use 'apt autoremove' to remove them. The following additional packages will be installed: autoconf automake autopoint autotools-dev debhelper debugedit dh-autoreconf dh-strip-nondeterminism dwz file fonts-font-awesome gettext gettext-base groff-base help2man icu-devtools intltool-debian libarchive-zip-perl libboost-atomic1.83-dev libboost-atomic1.83.0 libboost-chrono-dev libboost-chrono1.83-dev libboost-chrono1.83.0 libboost-filesystem-dev libboost-filesystem1.83-dev libboost-filesystem1.83.0 libboost-iostreams-dev libboost-iostreams1.83-dev libboost-iostreams1.83.0 libboost-regex1.83-dev libboost-regex1.83.0 libboost-system-dev libboost-system1.83-dev libboost-system1.83.0 libboost1.83-dev libbrotli1 libcurl3-gnutls libcurl4-gnutls-dev libdebhelper-perl libdeflate-dev libdeflate0 libdw1 libelf1 libexpat1 libfile-stripnondeterminism-perl libhts-dev libhts3 libhtscodecs2 libicu-dev libicu74 libjs-d3-format libjs-jquery libjs-jquery-datatables libjs-jquery-datatables-extensions libldap2 liblzma-dev libmagic-mgc libmagic1 libncurses-dev libncurses6 libnghttp2-14 libpipeline1 libpsl5 libpython3-stdlib libpython3.11-minimal libpython3.11-stdlib librtmp1 libsasl2-2 libsasl2-modules-db libssh-4 libsub-override-perl libtool libuchardet0 libxml2 m4 man-db media-types netbase node-commander node-d3 node-d3-array node-d3-axis node-d3-brush node-d3-chord node-d3-collection node-d3-color node-d3-contour node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease node-d3-fetch node-d3-force node-d3-format node-d3-geo node-d3-hierarchy node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic node-d3-selection node-d3-shape node-d3-time node-d3-time-format node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom node-iconv-lite node-normalize.css node-rw node-safe-buffer po-debconf python3 python3-minimal python3.11 python3.11-minimal zlib1g-dev Suggested packages: autoconf-archive gnu-standards autoconf-doc dh-make gettext-doc libasprintf-dev libgettextpo-dev groff libboost1.83-doc libboost-container1.83-dev libboost-context1.83-dev libboost-contract1.83-dev libboost-coroutine1.83-dev libboost-date-time1.83-dev libboost-exception1.83-dev libboost-fiber1.83-dev libboost-graph1.83-dev libboost-graph-parallel1.83-dev libboost-locale1.83-dev libboost-log1.83-dev libboost-math1.83-dev libboost-mpi1.83-dev libboost-mpi-python1.83-dev libboost-numpy1.83-dev libboost-program-options1.83-dev libboost-python1.83-dev libboost-random1.83-dev libboost-serialization1.83-dev libboost-stacktrace1.83-dev libboost-test1.83-dev libboost-thread1.83-dev libboost-timer1.83-dev libboost-type-erasure1.83-dev libboost-wave1.83-dev libboost1.83-tools-dev libmpfrc++-dev libntl-dev libboost-nowide1.83-dev libcurl4-doc libgnutls28-dev libidn-dev libkrb5-dev libldap2-dev librtmp-dev libssh2-1-dev pkg-config icu-doc liblzma-doc ncurses-doc libtool-doc gfortran | fortran95-compiler gcj-jdk m4-doc apparmor less www-browser libjs-html5shiv libmail-box-perl python3-doc python3-tk python3-venv python3.11-venv python3.11-doc binfmt-support Recommended packages: curl | wget | lynx libarchive-cpio-perl javascript-common libldap-common publicsuffix libsasl2-modules libltdl-dev libmail-sendmail-perl The following NEW packages will be installed: autoconf automake autopoint autotools-dev debhelper debugedit dh-autoreconf dh-strip-nondeterminism dwz file fonts-font-awesome gettext gettext-base groff-base help2man icu-devtools intltool-debian libarchive-zip-perl libboost-atomic1.83-dev libboost-atomic1.83.0 libboost-chrono-dev libboost-chrono1.83-dev libboost-chrono1.83.0 libboost-filesystem-dev libboost-filesystem1.83-dev libboost-filesystem1.83.0 libboost-iostreams-dev libboost-iostreams1.83-dev libboost-iostreams1.83.0 libboost-regex1.83-dev libboost-regex1.83.0 libboost-system-dev libboost-system1.83-dev libboost-system1.83.0 libboost1.83-dev libbrotli1 libcurl3-gnutls libcurl4-gnutls-dev libdebhelper-perl libdeflate-dev libdeflate0 libdw1 libelf1 libexpat1 libfile-stripnondeterminism-perl libhts-dev libhts3 libhtscodecs2 libicu-dev libicu74 libjs-d3-format libjs-jquery libjs-jquery-datatables libjs-jquery-datatables-extensions libldap2 liblzma-dev libmagic-mgc libmagic1 libncurses-dev libncurses6 libnghttp2-14 libpipeline1 libpsl5 libpython3-stdlib libpython3.11-minimal libpython3.11-stdlib librtmp1 libsasl2-2 libsasl2-modules-db libssh-4 libsub-override-perl libtool libuchardet0 libxml2 m4 man-db media-types netbase node-commander node-d3 node-d3-array node-d3-axis node-d3-brush node-d3-chord node-d3-collection node-d3-color node-d3-contour node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease node-d3-fetch node-d3-force node-d3-format node-d3-geo node-d3-hierarchy node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic node-d3-selection node-d3-shape node-d3-time node-d3-time-format node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom node-iconv-lite node-normalize.css node-rw node-safe-buffer po-debconf python3 python3-minimal python3.11 python3.11-minimal sbuild-build-depends-main-dummy zlib1g-dev 0 upgraded, 123 newly installed, 0 to remove and 0 not upgraded. Need to get 63.8 MB of archives. After this operation, 367 MB of additional disk space will be used. Get:1 copy:/<>/apt_archive ./ sbuild-build-depends-main-dummy 0.invalid.0 [784 B] Get:2 http://ftpmaster.internal/ubuntu noble/main amd64 libpython3.11-minimal amd64 3.11.7-2 [840 kB] Get:3 http://ftpmaster.internal/ubuntu noble/main amd64 libexpat1 amd64 2.5.0-2 [85.2 kB] Get:4 http://ftpmaster.internal/ubuntu noble/main amd64 python3.11-minimal amd64 3.11.7-2 [2219 kB] Get:5 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 python3-minimal amd64 3.11.4-5ubuntu1 [26.9 kB] Get:6 http://ftpmaster.internal/ubuntu noble/main amd64 media-types all 10.1.0 [27.5 kB] Get:7 http://ftpmaster.internal/ubuntu noble/main amd64 netbase all 6.4 [13.1 kB] Get:8 http://ftpmaster.internal/ubuntu noble/main amd64 libpython3.11-stdlib amd64 3.11.7-2 [1927 kB] Get:9 http://ftpmaster.internal/ubuntu noble/main amd64 python3.11 amd64 3.11.7-2 [583 kB] Get:10 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libpython3-stdlib amd64 3.11.4-5ubuntu1 [9562 B] Get:11 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 python3 amd64 3.11.4-5ubuntu1 [22.9 kB] Get:12 http://ftpmaster.internal/ubuntu noble/main amd64 libelf1 amd64 0.190-1 [57.0 kB] Get:13 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libicu74 amd64 74.2-1ubuntu1 [10.9 MB] Get:14 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libxml2 amd64 2.9.14+dfsg-1.3build3 [762 kB] Get:15 http://ftpmaster.internal/ubuntu noble/main amd64 libmagic-mgc amd64 1:5.45-2 [307 kB] Get:16 http://ftpmaster.internal/ubuntu noble/main amd64 libmagic1 amd64 1:5.45-2 [86.1 kB] Get:17 http://ftpmaster.internal/ubuntu noble/main amd64 file amd64 1:5.45-2 [21.9 kB] Get:18 http://ftpmaster.internal/ubuntu noble/main amd64 gettext-base amd64 0.21-14 [38.3 kB] Get:19 http://ftpmaster.internal/ubuntu noble/main amd64 libuchardet0 amd64 0.0.8-1 [75.3 kB] Get:20 http://ftpmaster.internal/ubuntu noble/main amd64 groff-base amd64 1.23.0-3 [1023 kB] Get:21 http://ftpmaster.internal/ubuntu noble/main amd64 libncurses6 amd64 6.4+20231209-1 [111 kB] Get:22 http://ftpmaster.internal/ubuntu noble/main amd64 libnghttp2-14 amd64 1.58.0-1 [73.2 kB] Get:23 http://ftpmaster.internal/ubuntu noble/main amd64 libpipeline1 amd64 1.5.7-1 [23.3 kB] Get:24 http://ftpmaster.internal/ubuntu noble/main amd64 libpsl5 amd64 0.21.2-1build1 [56.8 kB] Get:25 http://ftpmaster.internal/ubuntu noble/main amd64 man-db amd64 2.12.0-1 [1229 kB] Get:26 http://ftpmaster.internal/ubuntu noble/main amd64 m4 amd64 1.4.19-4 [243 kB] Get:27 http://ftpmaster.internal/ubuntu noble/main amd64 autoconf all 2.71-3 [339 kB] Get:28 http://ftpmaster.internal/ubuntu noble/main amd64 autotools-dev all 20220109.1 [44.9 kB] Get:29 http://ftpmaster.internal/ubuntu noble/main amd64 automake all 1:1.16.5-1.3 [558 kB] Get:30 http://ftpmaster.internal/ubuntu noble/main amd64 autopoint all 0.21-14 [422 kB] Get:31 http://ftpmaster.internal/ubuntu noble/main amd64 libdebhelper-perl all 13.11.8ubuntu1 [85.9 kB] Get:32 http://ftpmaster.internal/ubuntu noble/main amd64 libtool all 2.4.7-7 [166 kB] Get:33 http://ftpmaster.internal/ubuntu noble/main amd64 dh-autoreconf all 20 [16.1 kB] Get:34 http://ftpmaster.internal/ubuntu noble/main amd64 libarchive-zip-perl all 1.68-1 [90.2 kB] Get:35 http://ftpmaster.internal/ubuntu noble/main amd64 libsub-override-perl all 0.10-1 [10.0 kB] Get:36 http://ftpmaster.internal/ubuntu noble/main amd64 libfile-stripnondeterminism-perl all 1.13.1-1 [18.1 kB] Get:37 http://ftpmaster.internal/ubuntu noble/main amd64 dh-strip-nondeterminism all 1.13.1-1 [5362 B] Get:38 http://ftpmaster.internal/ubuntu noble/main amd64 libdw1 amd64 0.190-1 [260 kB] Get:39 http://ftpmaster.internal/ubuntu noble/main amd64 debugedit amd64 1:5.0-5 [46.1 kB] Get:40 http://ftpmaster.internal/ubuntu noble/main amd64 dwz amd64 0.15-1 [112 kB] Get:41 http://ftpmaster.internal/ubuntu noble/main amd64 gettext amd64 0.21-14 [865 kB] Get:42 http://ftpmaster.internal/ubuntu noble/main amd64 intltool-debian all 0.35.0+20060710.6 [23.2 kB] Get:43 http://ftpmaster.internal/ubuntu noble/main amd64 po-debconf all 1.0.21+nmu1 [233 kB] Get:44 http://ftpmaster.internal/ubuntu noble/main amd64 debhelper all 13.11.8ubuntu1 [940 kB] Get:45 http://ftpmaster.internal/ubuntu noble/main amd64 fonts-font-awesome all 5.0.10+really4.7.0~dfsg-4.1 [516 kB] Get:46 http://ftpmaster.internal/ubuntu noble/universe amd64 help2man amd64 1.49.3 [201 kB] Get:47 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 icu-devtools amd64 74.2-1ubuntu1 [212 kB] Get:48 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libboost1.83-dev amd64 1.83.0-1ubuntu3 [10.7 MB] Get:49 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libboost-atomic1.83.0 amd64 1.83.0-1ubuntu3 [240 kB] Get:50 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libboost-atomic1.83-dev amd64 1.83.0-1ubuntu3 [235 kB] Get:51 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libboost-chrono1.83.0 amd64 1.83.0-1ubuntu3 [244 kB] Get:52 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libboost-chrono1.83-dev amd64 1.83.0-1ubuntu3 [246 kB] Get:53 http://ftpmaster.internal/ubuntu noble-proposed/universe amd64 libboost-chrono-dev amd64 1.83.0.1ubuntu2 [4672 B] Get:54 http://ftpmaster.internal/ubuntu noble-proposed/universe amd64 libboost-filesystem1.83.0 amd64 1.83.0-1ubuntu3 [283 kB] Get:55 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libboost-system1.83.0 amd64 1.83.0-1ubuntu3 [236 kB] Get:56 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libboost-system1.83-dev amd64 1.83.0-1ubuntu3 [231 kB] Get:57 http://ftpmaster.internal/ubuntu noble-proposed/universe amd64 libboost-filesystem1.83-dev amd64 1.83.0-1ubuntu3 [301 kB] Get:58 http://ftpmaster.internal/ubuntu noble-proposed/universe amd64 libboost-filesystem-dev amd64 1.83.0.1ubuntu2 [4096 B] Get:59 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libboost-regex1.83.0 amd64 1.83.0-1ubuntu3 [339 kB] Get:60 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libicu-dev amd64 74.2-1ubuntu1 [11.9 MB] Get:61 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 libboost-regex1.83-dev amd64 1.83.0-1ubuntu3 [355 kB] Get:62 http://ftpmaster.internal/ubuntu noble-proposed/universe amd64 libboost-iostreams1.83.0 amd64 1.83.0-1ubuntu3 [259 kB] Get:63 http://ftpmaster.internal/ubuntu noble-proposed/universe amd64 libboost-iostreams1.83-dev amd64 1.83.0-1ubuntu3 [264 kB] Get:64 http://ftpmaster.internal/ubuntu noble-proposed/universe amd64 libboost-iostreams-dev amd64 1.83.0.1ubuntu2 [4046 B] Get:65 http://ftpmaster.internal/ubuntu noble-proposed/universe amd64 libboost-system-dev amd64 1.83.0.1ubuntu2 [4206 B] Get:66 http://ftpmaster.internal/ubuntu noble/main amd64 libbrotli1 amd64 1.1.0-2 [332 kB] Get:67 http://ftpmaster.internal/ubuntu noble/main amd64 libsasl2-modules-db amd64 2.1.28+dfsg1-4 [20.1 kB] Get:68 http://ftpmaster.internal/ubuntu noble/main amd64 libsasl2-2 amd64 2.1.28+dfsg1-4 [53.3 kB] Get:69 http://ftpmaster.internal/ubuntu noble/main amd64 libldap2 amd64 2.6.6+dfsg-1~exp1ubuntu1 [193 kB] Get:70 http://ftpmaster.internal/ubuntu noble/main amd64 librtmp1 amd64 2.4+20151223.gitfa8646d.1-2build4 [58.2 kB] Get:71 http://ftpmaster.internal/ubuntu noble/main amd64 libssh-4 amd64 0.10.5-3ubuntu1 [187 kB] Get:72 http://ftpmaster.internal/ubuntu noble/main amd64 libcurl3-gnutls amd64 8.4.0-2ubuntu1 [328 kB] Get:73 http://ftpmaster.internal/ubuntu noble/main amd64 libcurl4-gnutls-dev amd64 8.4.0-2ubuntu1 [436 kB] Get:74 http://ftpmaster.internal/ubuntu noble/main amd64 libdeflate0 amd64 1.18-1 [43.1 kB] Get:75 http://ftpmaster.internal/ubuntu noble/main amd64 libdeflate-dev amd64 1.18-1 [49.8 kB] Get:76 http://ftpmaster.internal/ubuntu noble/universe amd64 libhtscodecs2 amd64 1.6.0-1 [98.9 kB] Get:77 http://ftpmaster.internal/ubuntu noble/universe amd64 libhts3 amd64 1.18+ds-1 [428 kB] Get:78 http://ftpmaster.internal/ubuntu noble/main amd64 liblzma-dev amd64 5.4.5-0.1 [178 kB] Get:79 http://ftpmaster.internal/ubuntu noble-proposed/main amd64 zlib1g-dev amd64 1:1.3.dfsg-3ubuntu1 [896 kB] Get:80 http://ftpmaster.internal/ubuntu noble/universe amd64 libhts-dev amd64 1.18+ds-1 [5837 kB] Get:81 http://ftpmaster.internal/ubuntu noble/main amd64 libjs-jquery all 3.6.1+dfsg+~3.5.14-1 [328 kB] Get:82 http://ftpmaster.internal/ubuntu noble/universe amd64 libjs-jquery-datatables all 1.11.5+dfsg-2 [146 kB] Get:83 http://ftpmaster.internal/ubuntu noble/universe amd64 libjs-jquery-datatables-extensions all 0.0+git20150910.28fd64e+dfsg-5 [648 kB] Get:84 http://ftpmaster.internal/ubuntu noble/main amd64 libncurses-dev amd64 6.4+20231209-1 [382 kB] Get:85 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-array all 3.2.0+~cs5.0.6-2 [45.1 kB] Get:86 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-axis all 1.0.12+~1.0.16-1 [14.1 kB] Get:87 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-dispatch all 1.0.6+~1.0.9-1 [9774 B] Get:88 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-selection all 1.4.1+~1.4.3-1 [42.8 kB] Get:89 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-drag all 1.2.5+~1.2.5-1 [19.1 kB] Get:90 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-color all 1.4.1+~1.4.2-1 [19.9 kB] Get:91 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-interpolate all 1.4.0+~1.4.2-1 [24.0 kB] Get:92 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-ease all 1.0.7+~1.0.11-1 [12.5 kB] Get:93 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-timer all 1.0.10+~1.0.10-1 [10.6 kB] Get:94 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-transition all 1.3.2+~1.3.2-1 [28.7 kB] Get:95 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-brush all 1.1.6+~1.1.5-1 [181 kB] Get:96 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-path all 1.0.9+~1.0.9-1 [10.5 kB] Get:97 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-chord all 1.0.6+~1.0.11-1 [14.2 kB] Get:98 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-collection all 1.0.7+~1.0.10-1 [17.2 kB] Get:99 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-contour all 1.3.2+~1.3.3-1 [17.7 kB] Get:100 http://ftpmaster.internal/ubuntu noble/universe amd64 node-safe-buffer all 5.2.1+~cs2.1.2-3 [15.8 kB] Get:101 http://ftpmaster.internal/ubuntu noble/universe amd64 node-iconv-lite all 0.6.3-3 [158 kB] Get:102 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-queue all 3.0.7-13 [10.2 kB] Get:103 http://ftpmaster.internal/ubuntu noble/universe amd64 node-rw all 1.3.3-5 [7570 B] Get:104 http://ftpmaster.internal/ubuntu noble/universe amd64 node-commander all 9.4.1-1 [50.6 kB] Get:105 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-dsv all 1.2.0+~1.2.3-1 [17.7 kB] Get:106 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-fetch all 1.2.0+~1.2.2-1 [10.1 kB] Get:107 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-quadtree all 1.0.7+~1.0.9-1 [16.6 kB] Get:108 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-force all 2.1.1+~2.1.4-1 [30.9 kB] Get:109 http://ftpmaster.internal/ubuntu noble/universe amd64 libjs-d3-format all 1:1.4.5+~1.4.2-2 [18.2 kB] Get:110 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-format all 1:1.4.5+~1.4.2-2 [11.1 kB] Get:111 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-geo all 1.12.1+~1.12.4-1 [67.3 kB] Get:112 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-hierarchy all 1.1.9+~1.1.8-1 [35.1 kB] Get:113 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-polygon all 1.0.6+~1.0.8-1 [8744 B] Get:114 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-random all 1.1.2+~1.1.3-1 [9140 B] Get:115 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-time all 1.1.0+~1.1.1-1 [19.2 kB] Get:116 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-time-format all 2.3.0+~2.3.1-1 [23.8 kB] Get:117 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-scale all 2.2.2+~2.2.6-1 [43.4 kB] Get:118 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-scale-chromatic all 1.5.0+~1.5.1-1 [23.5 kB] Get:119 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-shape all 1.3.7+~1.3.8-1 [56.0 kB] Get:120 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-voronoi all 1.1.4+~1.1.9-1 [20.5 kB] Get:121 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3-zoom all 1.8.3+~1.8.4-1 [27.2 kB] Get:122 http://ftpmaster.internal/ubuntu noble/universe amd64 node-d3 all 5.16.0+~cs5.28.10-1 [194 kB] Get:123 http://ftpmaster.internal/ubuntu noble/universe amd64 node-normalize.css all 8.0.1-5 [10.8 kB] Preconfiguring packages ... Fetched 63.8 MB in 1s (93.6 MB/s) Selecting previously unselected package libpython3.11-minimal:amd64. (Reading database ... 13841 files and directories currently installed.) Preparing to unpack .../libpython3.11-minimal_3.11.7-2_amd64.deb ... Unpacking libpython3.11-minimal:amd64 (3.11.7-2) ... Selecting previously unselected package libexpat1:amd64. Preparing to unpack .../libexpat1_2.5.0-2_amd64.deb ... Unpacking libexpat1:amd64 (2.5.0-2) ... Selecting previously unselected package python3.11-minimal. Preparing to unpack .../python3.11-minimal_3.11.7-2_amd64.deb ... Unpacking python3.11-minimal (3.11.7-2) ... Setting up libpython3.11-minimal:amd64 (3.11.7-2) ... Setting up libexpat1:amd64 (2.5.0-2) ... Setting up python3.11-minimal (3.11.7-2) ... Selecting previously unselected package python3-minimal. (Reading database ... 14155 files and directories currently installed.) Preparing to unpack .../0-python3-minimal_3.11.4-5ubuntu1_amd64.deb ... Unpacking python3-minimal (3.11.4-5ubuntu1) ... Selecting previously unselected package media-types. Preparing to unpack .../1-media-types_10.1.0_all.deb ... Unpacking media-types (10.1.0) ... Selecting previously unselected package netbase. Preparing to unpack .../2-netbase_6.4_all.deb ... Unpacking netbase (6.4) ... Selecting previously unselected package libpython3.11-stdlib:amd64. Preparing to unpack .../3-libpython3.11-stdlib_3.11.7-2_amd64.deb ... Unpacking libpython3.11-stdlib:amd64 (3.11.7-2) ... Selecting previously unselected package python3.11. Preparing to unpack .../4-python3.11_3.11.7-2_amd64.deb ... Unpacking python3.11 (3.11.7-2) ... Selecting previously unselected package libpython3-stdlib:amd64. Preparing to unpack .../5-libpython3-stdlib_3.11.4-5ubuntu1_amd64.deb ... Unpacking libpython3-stdlib:amd64 (3.11.4-5ubuntu1) ... Setting up python3-minimal (3.11.4-5ubuntu1) ... Selecting previously unselected package python3. (Reading database ... 14589 files and directories currently installed.) Preparing to unpack .../000-python3_3.11.4-5ubuntu1_amd64.deb ... Unpacking python3 (3.11.4-5ubuntu1) ... Selecting previously unselected package libelf1:amd64. Preparing to unpack .../001-libelf1_0.190-1_amd64.deb ... Unpacking libelf1:amd64 (0.190-1) ... Selecting previously unselected package libicu74:amd64. Preparing to unpack .../002-libicu74_74.2-1ubuntu1_amd64.deb ... Unpacking libicu74:amd64 (74.2-1ubuntu1) ... Selecting previously unselected package libxml2:amd64. Preparing to unpack .../003-libxml2_2.9.14+dfsg-1.3build3_amd64.deb ... Unpacking libxml2:amd64 (2.9.14+dfsg-1.3build3) ... Selecting previously unselected package libmagic-mgc. Preparing to unpack .../004-libmagic-mgc_1%3a5.45-2_amd64.deb ... Unpacking libmagic-mgc (1:5.45-2) ... Selecting previously unselected package libmagic1:amd64. Preparing to unpack .../005-libmagic1_1%3a5.45-2_amd64.deb ... Unpacking libmagic1:amd64 (1:5.45-2) ... Selecting previously unselected package file. Preparing to unpack .../006-file_1%3a5.45-2_amd64.deb ... Unpacking file (1:5.45-2) ... Selecting previously unselected package gettext-base. Preparing to unpack .../007-gettext-base_0.21-14_amd64.deb ... Unpacking gettext-base (0.21-14) ... Selecting previously unselected package libuchardet0:amd64. Preparing to unpack .../008-libuchardet0_0.0.8-1_amd64.deb ... Unpacking libuchardet0:amd64 (0.0.8-1) ... Selecting previously unselected package groff-base. Preparing to unpack .../009-groff-base_1.23.0-3_amd64.deb ... Unpacking groff-base (1.23.0-3) ... Selecting previously unselected package libncurses6:amd64. Preparing to unpack .../010-libncurses6_6.4+20231209-1_amd64.deb ... Unpacking libncurses6:amd64 (6.4+20231209-1) ... Selecting previously unselected package libnghttp2-14:amd64. Preparing to unpack .../011-libnghttp2-14_1.58.0-1_amd64.deb ... Unpacking libnghttp2-14:amd64 (1.58.0-1) ... Selecting previously unselected package libpipeline1:amd64. Preparing to unpack .../012-libpipeline1_1.5.7-1_amd64.deb ... Unpacking libpipeline1:amd64 (1.5.7-1) ... Selecting previously unselected package libpsl5:amd64. Preparing to unpack .../013-libpsl5_0.21.2-1build1_amd64.deb ... Unpacking libpsl5:amd64 (0.21.2-1build1) ... Selecting previously unselected package man-db. Preparing to unpack .../014-man-db_2.12.0-1_amd64.deb ... Unpacking man-db (2.12.0-1) ... Selecting previously unselected package m4. Preparing to unpack .../015-m4_1.4.19-4_amd64.deb ... Unpacking m4 (1.4.19-4) ... Selecting previously unselected package autoconf. Preparing to unpack .../016-autoconf_2.71-3_all.deb ... Unpacking autoconf (2.71-3) ... Selecting previously unselected package autotools-dev. Preparing to unpack .../017-autotools-dev_20220109.1_all.deb ... Unpacking autotools-dev (20220109.1) ... Selecting previously unselected package automake. Preparing to unpack .../018-automake_1%3a1.16.5-1.3_all.deb ... Unpacking automake (1:1.16.5-1.3) ... Selecting previously unselected package autopoint. Preparing to unpack .../019-autopoint_0.21-14_all.deb ... Unpacking autopoint (0.21-14) ... Selecting previously unselected package libdebhelper-perl. Preparing to unpack .../020-libdebhelper-perl_13.11.8ubuntu1_all.deb ... Unpacking libdebhelper-perl (13.11.8ubuntu1) ... Selecting previously unselected package libtool. Preparing to unpack .../021-libtool_2.4.7-7_all.deb ... Unpacking libtool (2.4.7-7) ... Selecting previously unselected package dh-autoreconf. Preparing to unpack .../022-dh-autoreconf_20_all.deb ... Unpacking dh-autoreconf (20) ... Selecting previously unselected package libarchive-zip-perl. Preparing to unpack .../023-libarchive-zip-perl_1.68-1_all.deb ... Unpacking libarchive-zip-perl (1.68-1) ... Selecting previously unselected package libsub-override-perl. Preparing to unpack .../024-libsub-override-perl_0.10-1_all.deb ... Unpacking libsub-override-perl (0.10-1) ... Selecting previously unselected package libfile-stripnondeterminism-perl. Preparing to unpack .../025-libfile-stripnondeterminism-perl_1.13.1-1_all.deb ... Unpacking libfile-stripnondeterminism-perl (1.13.1-1) ... Selecting previously unselected package dh-strip-nondeterminism. Preparing to unpack .../026-dh-strip-nondeterminism_1.13.1-1_all.deb ... Unpacking dh-strip-nondeterminism (1.13.1-1) ... Selecting previously unselected package libdw1:amd64. Preparing to unpack .../027-libdw1_0.190-1_amd64.deb ... Unpacking libdw1:amd64 (0.190-1) ... Selecting previously unselected package debugedit. Preparing to unpack .../028-debugedit_1%3a5.0-5_amd64.deb ... Unpacking debugedit (1:5.0-5) ... Selecting previously unselected package dwz. Preparing to unpack .../029-dwz_0.15-1_amd64.deb ... Unpacking dwz (0.15-1) ... Selecting previously unselected package gettext. Preparing to unpack .../030-gettext_0.21-14_amd64.deb ... Unpacking gettext (0.21-14) ... Selecting previously unselected package intltool-debian. Preparing to unpack .../031-intltool-debian_0.35.0+20060710.6_all.deb ... Unpacking intltool-debian (0.35.0+20060710.6) ... Selecting previously unselected package po-debconf. Preparing to unpack .../032-po-debconf_1.0.21+nmu1_all.deb ... Unpacking po-debconf (1.0.21+nmu1) ... Selecting previously unselected package debhelper. Preparing to unpack .../033-debhelper_13.11.8ubuntu1_all.deb ... Unpacking debhelper (13.11.8ubuntu1) ... Selecting previously unselected package fonts-font-awesome. Preparing to unpack .../034-fonts-font-awesome_5.0.10+really4.7.0~dfsg-4.1_all.deb ... Unpacking fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... Selecting previously unselected package help2man. Preparing to unpack .../035-help2man_1.49.3_amd64.deb ... Unpacking help2man (1.49.3) ... Selecting previously unselected package icu-devtools. Preparing to unpack .../036-icu-devtools_74.2-1ubuntu1_amd64.deb ... Unpacking icu-devtools (74.2-1ubuntu1) ... Selecting previously unselected package libboost1.83-dev:amd64. Preparing to unpack .../037-libboost1.83-dev_1.83.0-1ubuntu3_amd64.deb ... Unpacking libboost1.83-dev:amd64 (1.83.0-1ubuntu3) ... Selecting previously unselected package libboost-atomic1.83.0:amd64. Preparing to unpack .../038-libboost-atomic1.83.0_1.83.0-1ubuntu3_amd64.deb ... Unpacking libboost-atomic1.83.0:amd64 (1.83.0-1ubuntu3) ... Selecting previously unselected package libboost-atomic1.83-dev:amd64. Preparing to unpack .../039-libboost-atomic1.83-dev_1.83.0-1ubuntu3_amd64.deb ... Unpacking libboost-atomic1.83-dev:amd64 (1.83.0-1ubuntu3) ... Selecting previously unselected package libboost-chrono1.83.0:amd64. Preparing to unpack .../040-libboost-chrono1.83.0_1.83.0-1ubuntu3_amd64.deb ... Unpacking libboost-chrono1.83.0:amd64 (1.83.0-1ubuntu3) ... Selecting previously unselected package libboost-chrono1.83-dev:amd64. Preparing to unpack .../041-libboost-chrono1.83-dev_1.83.0-1ubuntu3_amd64.deb ... Unpacking libboost-chrono1.83-dev:amd64 (1.83.0-1ubuntu3) ... Selecting previously unselected package libboost-chrono-dev:amd64. Preparing to unpack .../042-libboost-chrono-dev_1.83.0.1ubuntu2_amd64.deb ... Unpacking libboost-chrono-dev:amd64 (1.83.0.1ubuntu2) ... Selecting previously unselected package libboost-filesystem1.83.0:amd64. Preparing to unpack .../043-libboost-filesystem1.83.0_1.83.0-1ubuntu3_amd64.deb ... Unpacking libboost-filesystem1.83.0:amd64 (1.83.0-1ubuntu3) ... Selecting previously unselected package libboost-system1.83.0:amd64. Preparing to unpack .../044-libboost-system1.83.0_1.83.0-1ubuntu3_amd64.deb ... Unpacking libboost-system1.83.0:amd64 (1.83.0-1ubuntu3) ... Selecting previously unselected package libboost-system1.83-dev:amd64. Preparing to unpack .../045-libboost-system1.83-dev_1.83.0-1ubuntu3_amd64.deb ... Unpacking libboost-system1.83-dev:amd64 (1.83.0-1ubuntu3) ... Selecting previously unselected package libboost-filesystem1.83-dev:amd64. Preparing to unpack .../046-libboost-filesystem1.83-dev_1.83.0-1ubuntu3_amd64.deb ... Unpacking libboost-filesystem1.83-dev:amd64 (1.83.0-1ubuntu3) ... Selecting previously unselected package libboost-filesystem-dev:amd64. Preparing to unpack .../047-libboost-filesystem-dev_1.83.0.1ubuntu2_amd64.deb ... Unpacking libboost-filesystem-dev:amd64 (1.83.0.1ubuntu2) ... Selecting previously unselected package libboost-regex1.83.0:amd64. Preparing to unpack .../048-libboost-regex1.83.0_1.83.0-1ubuntu3_amd64.deb ... Unpacking libboost-regex1.83.0:amd64 (1.83.0-1ubuntu3) ... Selecting previously unselected package libicu-dev:amd64. Preparing to unpack .../049-libicu-dev_74.2-1ubuntu1_amd64.deb ... Unpacking libicu-dev:amd64 (74.2-1ubuntu1) ... Selecting previously unselected package libboost-regex1.83-dev:amd64. Preparing to unpack .../050-libboost-regex1.83-dev_1.83.0-1ubuntu3_amd64.deb ... Unpacking libboost-regex1.83-dev:amd64 (1.83.0-1ubuntu3) ... Selecting previously unselected package libboost-iostreams1.83.0:amd64. Preparing to unpack .../051-libboost-iostreams1.83.0_1.83.0-1ubuntu3_amd64.deb ... Unpacking libboost-iostreams1.83.0:amd64 (1.83.0-1ubuntu3) ... Selecting previously unselected package libboost-iostreams1.83-dev:amd64. Preparing to unpack .../052-libboost-iostreams1.83-dev_1.83.0-1ubuntu3_amd64.deb ... Unpacking libboost-iostreams1.83-dev:amd64 (1.83.0-1ubuntu3) ... Selecting previously unselected package libboost-iostreams-dev:amd64. Preparing to unpack .../053-libboost-iostreams-dev_1.83.0.1ubuntu2_amd64.deb ... Unpacking libboost-iostreams-dev:amd64 (1.83.0.1ubuntu2) ... Selecting previously unselected package libboost-system-dev:amd64. Preparing to unpack .../054-libboost-system-dev_1.83.0.1ubuntu2_amd64.deb ... Unpacking libboost-system-dev:amd64 (1.83.0.1ubuntu2) ... Selecting previously unselected package libbrotli1:amd64. Preparing to unpack .../055-libbrotli1_1.1.0-2_amd64.deb ... Unpacking libbrotli1:amd64 (1.1.0-2) ... Selecting previously unselected package libsasl2-modules-db:amd64. Preparing to unpack .../056-libsasl2-modules-db_2.1.28+dfsg1-4_amd64.deb ... Unpacking libsasl2-modules-db:amd64 (2.1.28+dfsg1-4) ... Selecting previously unselected package libsasl2-2:amd64. Preparing to unpack .../057-libsasl2-2_2.1.28+dfsg1-4_amd64.deb ... Unpacking libsasl2-2:amd64 (2.1.28+dfsg1-4) ... Selecting previously unselected package libldap2:amd64. Preparing to unpack .../058-libldap2_2.6.6+dfsg-1~exp1ubuntu1_amd64.deb ... Unpacking libldap2:amd64 (2.6.6+dfsg-1~exp1ubuntu1) ... Selecting previously unselected package librtmp1:amd64. Preparing to unpack .../059-librtmp1_2.4+20151223.gitfa8646d.1-2build4_amd64.deb ... Unpacking librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2build4) ... Selecting previously unselected package libssh-4:amd64. Preparing to unpack .../060-libssh-4_0.10.5-3ubuntu1_amd64.deb ... Unpacking libssh-4:amd64 (0.10.5-3ubuntu1) ... Selecting previously unselected package libcurl3-gnutls:amd64. Preparing to unpack .../061-libcurl3-gnutls_8.4.0-2ubuntu1_amd64.deb ... Unpacking libcurl3-gnutls:amd64 (8.4.0-2ubuntu1) ... Selecting previously unselected package libcurl4-gnutls-dev:amd64. Preparing to unpack .../062-libcurl4-gnutls-dev_8.4.0-2ubuntu1_amd64.deb ... Unpacking libcurl4-gnutls-dev:amd64 (8.4.0-2ubuntu1) ... Selecting previously unselected package libdeflate0:amd64. Preparing to unpack .../063-libdeflate0_1.18-1_amd64.deb ... Unpacking libdeflate0:amd64 (1.18-1) ... Selecting previously unselected package libdeflate-dev:amd64. Preparing to unpack .../064-libdeflate-dev_1.18-1_amd64.deb ... Unpacking libdeflate-dev:amd64 (1.18-1) ... Selecting previously unselected package libhtscodecs2:amd64. Preparing to unpack .../065-libhtscodecs2_1.6.0-1_amd64.deb ... Unpacking libhtscodecs2:amd64 (1.6.0-1) ... Selecting previously unselected package libhts3:amd64. Preparing to unpack .../066-libhts3_1.18+ds-1_amd64.deb ... Unpacking libhts3:amd64 (1.18+ds-1) ... Selecting previously unselected package liblzma-dev:amd64. Preparing to unpack .../067-liblzma-dev_5.4.5-0.1_amd64.deb ... Unpacking liblzma-dev:amd64 (5.4.5-0.1) ... Selecting previously unselected package zlib1g-dev:amd64. Preparing to unpack .../068-zlib1g-dev_1%3a1.3.dfsg-3ubuntu1_amd64.deb ... Unpacking zlib1g-dev:amd64 (1:1.3.dfsg-3ubuntu1) ... Selecting previously unselected package libhts-dev:amd64. Preparing to unpack .../069-libhts-dev_1.18+ds-1_amd64.deb ... Unpacking libhts-dev:amd64 (1.18+ds-1) ... Selecting previously unselected package libjs-jquery. Preparing to unpack .../070-libjs-jquery_3.6.1+dfsg+~3.5.14-1_all.deb ... Unpacking libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... Selecting previously unselected package libjs-jquery-datatables. Preparing to unpack .../071-libjs-jquery-datatables_1.11.5+dfsg-2_all.deb ... Unpacking libjs-jquery-datatables (1.11.5+dfsg-2) ... Selecting previously unselected package libjs-jquery-datatables-extensions. Preparing to unpack .../072-libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-5_all.deb ... Unpacking libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... Selecting previously unselected package libncurses-dev:amd64. Preparing to unpack .../073-libncurses-dev_6.4+20231209-1_amd64.deb ... Unpacking libncurses-dev:amd64 (6.4+20231209-1) ... Selecting previously unselected package node-d3-array. Preparing to unpack .../074-node-d3-array_3.2.0+~cs5.0.6-2_all.deb ... Unpacking node-d3-array (3.2.0+~cs5.0.6-2) ... Selecting previously unselected package node-d3-axis. Preparing to unpack .../075-node-d3-axis_1.0.12+~1.0.16-1_all.deb ... Unpacking node-d3-axis (1.0.12+~1.0.16-1) ... Selecting previously unselected package node-d3-dispatch. Preparing to unpack .../076-node-d3-dispatch_1.0.6+~1.0.9-1_all.deb ... Unpacking node-d3-dispatch (1.0.6+~1.0.9-1) ... Selecting previously unselected package node-d3-selection. Preparing to unpack .../077-node-d3-selection_1.4.1+~1.4.3-1_all.deb ... Unpacking node-d3-selection (1.4.1+~1.4.3-1) ... Selecting previously unselected package node-d3-drag. Preparing to unpack .../078-node-d3-drag_1.2.5+~1.2.5-1_all.deb ... Unpacking node-d3-drag (1.2.5+~1.2.5-1) ... Selecting previously unselected package node-d3-color. Preparing to unpack .../079-node-d3-color_1.4.1+~1.4.2-1_all.deb ... Unpacking node-d3-color (1.4.1+~1.4.2-1) ... Selecting previously unselected package node-d3-interpolate. Preparing to unpack .../080-node-d3-interpolate_1.4.0+~1.4.2-1_all.deb ... Unpacking node-d3-interpolate (1.4.0+~1.4.2-1) ... Selecting previously unselected package node-d3-ease. Preparing to unpack .../081-node-d3-ease_1.0.7+~1.0.11-1_all.deb ... Unpacking node-d3-ease (1.0.7+~1.0.11-1) ... Selecting previously unselected package node-d3-timer. Preparing to unpack .../082-node-d3-timer_1.0.10+~1.0.10-1_all.deb ... Unpacking node-d3-timer (1.0.10+~1.0.10-1) ... Selecting previously unselected package node-d3-transition. Preparing to unpack .../083-node-d3-transition_1.3.2+~1.3.2-1_all.deb ... Unpacking node-d3-transition (1.3.2+~1.3.2-1) ... Selecting previously unselected package node-d3-brush. Preparing to unpack .../084-node-d3-brush_1.1.6+~1.1.5-1_all.deb ... Unpacking node-d3-brush (1.1.6+~1.1.5-1) ... Selecting previously unselected package node-d3-path. Preparing to unpack .../085-node-d3-path_1.0.9+~1.0.9-1_all.deb ... Unpacking node-d3-path (1.0.9+~1.0.9-1) ... Selecting previously unselected package node-d3-chord. Preparing to unpack .../086-node-d3-chord_1.0.6+~1.0.11-1_all.deb ... Unpacking node-d3-chord (1.0.6+~1.0.11-1) ... Selecting previously unselected package node-d3-collection. Preparing to unpack .../087-node-d3-collection_1.0.7+~1.0.10-1_all.deb ... Unpacking node-d3-collection (1.0.7+~1.0.10-1) ... Selecting previously unselected package node-d3-contour. Preparing to unpack .../088-node-d3-contour_1.3.2+~1.3.3-1_all.deb ... Unpacking node-d3-contour (1.3.2+~1.3.3-1) ... Selecting previously unselected package node-safe-buffer. Preparing to unpack .../089-node-safe-buffer_5.2.1+~cs2.1.2-3_all.deb ... Unpacking node-safe-buffer (5.2.1+~cs2.1.2-3) ... Selecting previously unselected package node-iconv-lite. Preparing to unpack .../090-node-iconv-lite_0.6.3-3_all.deb ... Unpacking node-iconv-lite (0.6.3-3) ... Selecting previously unselected package node-d3-queue. Preparing to unpack .../091-node-d3-queue_3.0.7-13_all.deb ... Unpacking node-d3-queue (3.0.7-13) ... Selecting previously unselected package node-rw. Preparing to unpack .../092-node-rw_1.3.3-5_all.deb ... Unpacking node-rw (1.3.3-5) ... Selecting previously unselected package node-commander. Preparing to unpack .../093-node-commander_9.4.1-1_all.deb ... Unpacking node-commander (9.4.1-1) ... Selecting previously unselected package node-d3-dsv. Preparing to unpack .../094-node-d3-dsv_1.2.0+~1.2.3-1_all.deb ... Unpacking node-d3-dsv (1.2.0+~1.2.3-1) ... Selecting previously unselected package node-d3-fetch. Preparing to unpack .../095-node-d3-fetch_1.2.0+~1.2.2-1_all.deb ... Unpacking node-d3-fetch (1.2.0+~1.2.2-1) ... Selecting previously unselected package node-d3-quadtree. Preparing to unpack .../096-node-d3-quadtree_1.0.7+~1.0.9-1_all.deb ... Unpacking node-d3-quadtree (1.0.7+~1.0.9-1) ... Selecting previously unselected package node-d3-force. Preparing to unpack .../097-node-d3-force_2.1.1+~2.1.4-1_all.deb ... Unpacking node-d3-force (2.1.1+~2.1.4-1) ... Selecting previously unselected package libjs-d3-format. Preparing to unpack .../098-libjs-d3-format_1%3a1.4.5+~1.4.2-2_all.deb ... Unpacking libjs-d3-format (1:1.4.5+~1.4.2-2) ... Selecting previously unselected package node-d3-format. Preparing to unpack .../099-node-d3-format_1%3a1.4.5+~1.4.2-2_all.deb ... Unpacking node-d3-format (1:1.4.5+~1.4.2-2) ... Selecting previously unselected package node-d3-geo. Preparing to unpack .../100-node-d3-geo_1.12.1+~1.12.4-1_all.deb ... Unpacking node-d3-geo (1.12.1+~1.12.4-1) ... Selecting previously unselected package node-d3-hierarchy. Preparing to unpack .../101-node-d3-hierarchy_1.1.9+~1.1.8-1_all.deb ... Unpacking node-d3-hierarchy (1.1.9+~1.1.8-1) ... Selecting previously unselected package node-d3-polygon. Preparing to unpack .../102-node-d3-polygon_1.0.6+~1.0.8-1_all.deb ... Unpacking node-d3-polygon (1.0.6+~1.0.8-1) ... Selecting previously unselected package node-d3-random. Preparing to unpack .../103-node-d3-random_1.1.2+~1.1.3-1_all.deb ... Unpacking node-d3-random (1.1.2+~1.1.3-1) ... Selecting previously unselected package node-d3-time. Preparing to unpack .../104-node-d3-time_1.1.0+~1.1.1-1_all.deb ... Unpacking node-d3-time (1.1.0+~1.1.1-1) ... Selecting previously unselected package node-d3-time-format. Preparing to unpack .../105-node-d3-time-format_2.3.0+~2.3.1-1_all.deb ... Unpacking node-d3-time-format (2.3.0+~2.3.1-1) ... Selecting previously unselected package node-d3-scale. Preparing to unpack .../106-node-d3-scale_2.2.2+~2.2.6-1_all.deb ... Unpacking node-d3-scale (2.2.2+~2.2.6-1) ... Selecting previously unselected package node-d3-scale-chromatic. Preparing to unpack .../107-node-d3-scale-chromatic_1.5.0+~1.5.1-1_all.deb ... Unpacking node-d3-scale-chromatic (1.5.0+~1.5.1-1) ... Selecting previously unselected package node-d3-shape. Preparing to unpack .../108-node-d3-shape_1.3.7+~1.3.8-1_all.deb ... Unpacking node-d3-shape (1.3.7+~1.3.8-1) ... Selecting previously unselected package node-d3-voronoi. Preparing to unpack .../109-node-d3-voronoi_1.1.4+~1.1.9-1_all.deb ... Unpacking node-d3-voronoi (1.1.4+~1.1.9-1) ... Selecting previously unselected package node-d3-zoom. Preparing to unpack .../110-node-d3-zoom_1.8.3+~1.8.4-1_all.deb ... Unpacking node-d3-zoom (1.8.3+~1.8.4-1) ... Selecting previously unselected package node-d3. Preparing to unpack .../111-node-d3_5.16.0+~cs5.28.10-1_all.deb ... Unpacking node-d3 (5.16.0+~cs5.28.10-1) ... Selecting previously unselected package node-normalize.css. Preparing to unpack .../112-node-normalize.css_8.0.1-5_all.deb ... Unpacking node-normalize.css (8.0.1-5) ... Selecting previously unselected package sbuild-build-depends-main-dummy. Preparing to unpack .../113-sbuild-build-depends-main-dummy_0.invalid.0_amd64.deb ... Unpacking sbuild-build-depends-main-dummy (0.invalid.0) ... Setting up libhtscodecs2:amd64 (1.6.0-1) ... Setting up media-types (10.1.0) ... Setting up libpipeline1:amd64 (1.5.7-1) ... Setting up node-d3-timer (1.0.10+~1.0.10-1) ... Setting up node-d3-color (1.4.1+~1.4.2-1) ... Setting up libboost1.83-dev:amd64 (1.83.0-1ubuntu3) ... Setting up node-d3-interpolate (1.4.0+~1.4.2-1) ... Setting up node-d3-queue (3.0.7-13) ... Setting up libpsl5:amd64 (0.21.2-1build1) ... Setting up node-d3-hierarchy (1.1.9+~1.1.8-1) ... Setting up node-d3-ease (1.0.7+~1.0.11-1) ... Setting up libmagic-mgc (1:5.45-2) ... Setting up libarchive-zip-perl (1.68-1) ... Setting up node-d3-scale-chromatic (1.5.0+~1.5.1-1) ... Setting up libboost-regex1.83.0:amd64 (1.83.0-1ubuntu3) ... Setting up libdebhelper-perl (13.11.8ubuntu1) ... Setting up libbrotli1:amd64 (1.1.0-2) ... Setting up libboost-system1.83.0:amd64 (1.83.0-1ubuntu3) ... Setting up libnghttp2-14:amd64 (1.58.0-1) ... Setting up libmagic1:amd64 (1:5.45-2) ... Setting up libdeflate0:amd64 (1.18-1) ... Setting up gettext-base (0.21-14) ... Setting up m4 (1.4.19-4) ... Setting up node-d3-selection (1.4.1+~1.4.3-1) ... Setting up node-d3-axis (1.0.12+~1.0.16-1) ... Setting up file (1:5.45-2) ... Setting up libboost-filesystem1.83.0:amd64 (1.83.0-1ubuntu3) ... Setting up node-d3-path (1.0.9+~1.0.9-1) ... Setting up libsasl2-modules-db:amd64 (2.1.28+dfsg1-4) ... Setting up libboost-atomic1.83.0:amd64 (1.83.0-1ubuntu3) ... Setting up help2man (1.49.3) ... Setting up autotools-dev (20220109.1) ... Setting up node-safe-buffer (5.2.1+~cs2.1.2-3) ... Setting up node-rw (1.3.3-5) ... Setting up node-d3-polygon (1.0.6+~1.0.8-1) ... Setting up node-d3-quadtree (1.0.7+~1.0.9-1) ... Setting up librtmp1:amd64 (2.4+20151223.gitfa8646d.1-2build4) ... Setting up libboost-iostreams1.83.0:amd64 (1.83.0-1ubuntu3) ... Setting up libncurses6:amd64 (6.4+20231209-1) ... Setting up node-d3-collection (1.0.7+~1.0.10-1) ... Setting up autopoint (0.21-14) ... Setting up libsasl2-2:amd64 (2.1.28+dfsg1-4) ... Setting up libssh-4:amd64 (0.10.5-3ubuntu1) ... Setting up libboost-atomic1.83-dev:amd64 (1.83.0-1ubuntu3) ... Setting up autoconf (2.71-3) ... Setting up node-d3-voronoi (1.1.4+~1.1.9-1) ... Setting up node-d3-dispatch (1.0.6+~1.0.9-1) ... Setting up node-d3-time (1.1.0+~1.1.1-1) ... Setting up liblzma-dev:amd64 (5.4.5-0.1) ... Setting up libicu74:amd64 (74.2-1ubuntu1) ... Setting up zlib1g-dev:amd64 (1:1.3.dfsg-3ubuntu1) ... Setting up node-commander (9.4.1-1) ... Setting up node-d3-array (3.2.0+~cs5.0.6-2) ... Setting up libjs-d3-format (1:1.4.5+~1.4.2-2) ... Setting up libboost-chrono1.83.0:amd64 (1.83.0-1ubuntu3) ... Setting up libuchardet0:amd64 (0.0.8-1) ... Setting up libsub-override-perl (0.10-1) ... Setting up netbase (6.4) ... Setting up libboost-system1.83-dev:amd64 (1.83.0-1ubuntu3) ... Setting up libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... Setting up node-d3-geo (1.12.1+~1.12.4-1) ... Setting up libdeflate-dev:amd64 (1.18-1) ... Setting up node-normalize.css (8.0.1-5) ... Setting up node-d3-transition (1.3.2+~1.3.2-1) ... Setting up libelf1:amd64 (0.190-1) ... Setting up libxml2:amd64 (2.9.14+dfsg-1.3build3) ... Setting up fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... Setting up libldap2:amd64 (2.6.6+dfsg-1~exp1ubuntu1) ... Setting up node-d3-random (1.1.2+~1.1.3-1) ... Setting up libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... Setting up automake (1:1.16.5-1.3) ... update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode Setting up libfile-stripnondeterminism-perl (1.13.1-1) ... Setting up libdw1:amd64 (0.190-1) ... Setting up libncurses-dev:amd64 (6.4+20231209-1) ... Setting up gettext (0.21-14) ... Setting up node-d3-format (1:1.4.5+~1.4.2-2) ... Setting up libboost-chrono1.83-dev:amd64 (1.83.0-1ubuntu3) ... Setting up libtool (2.4.7-7) ... Setting up libboost-chrono-dev:amd64 (1.83.0.1ubuntu2) ... Setting up node-d3-time-format (2.3.0+~2.3.1-1) ... Setting up libpython3.11-stdlib:amd64 (3.11.7-2) ... Setting up libboost-system-dev:amd64 (1.83.0.1ubuntu2) ... Setting up node-d3-chord (1.0.6+~1.0.11-1) ... Setting up libcurl3-gnutls:amd64 (8.4.0-2ubuntu1) ... Setting up libboost-filesystem1.83-dev:amd64 (1.83.0-1ubuntu3) ... Setting up libcurl4-gnutls-dev:amd64 (8.4.0-2ubuntu1) ... Setting up node-d3-shape (1.3.7+~1.3.8-1) ... Setting up libjs-jquery-datatables (1.11.5+dfsg-2) ... Setting up intltool-debian (0.35.0+20060710.6) ... Setting up dh-autoreconf (20) ... Setting up node-d3-drag (1.2.5+~1.2.5-1) ... Setting up node-iconv-lite (0.6.3-3) ... Setting up node-d3-scale (2.2.2+~2.2.6-1) ... Setting up icu-devtools (74.2-1ubuntu1) ... Setting up node-d3-force (2.1.1+~2.1.4-1) ... Setting up node-d3-contour (1.3.2+~1.3.3-1) ... Setting up dh-strip-nondeterminism (1.13.1-1) ... Setting up dwz (0.15-1) ... Setting up node-d3-brush (1.1.6+~1.1.5-1) ... Setting up groff-base (1.23.0-3) ... Setting up debugedit (1:5.0-5) ... Setting up node-d3-dsv (1.2.0+~1.2.3-1) ... Setting up libicu-dev:amd64 (74.2-1ubuntu1) ... Setting up libboost-filesystem-dev:amd64 (1.83.0.1ubuntu2) ... Setting up libpython3-stdlib:amd64 (3.11.4-5ubuntu1) ... Setting up python3.11 (3.11.7-2) ... Setting up libhts3:amd64 (1.18+ds-1) ... Setting up node-d3-zoom (1.8.3+~1.8.4-1) ... Setting up po-debconf (1.0.21+nmu1) ... Setting up libhts-dev:amd64 (1.18+ds-1) ... Setting up node-d3-fetch (1.2.0+~1.2.2-1) ... Setting up python3 (3.11.4-5ubuntu1) ... Setting up node-d3 (5.16.0+~cs5.28.10-1) ... Setting up man-db (2.12.0-1) ... Not building database; man-db/auto-update is not 'true'. Created symlink /etc/systemd/system/timers.target.wants/man-db.timer → /usr/lib/systemd/system/man-db.timer. Setting up libboost-regex1.83-dev:amd64 (1.83.0-1ubuntu3) ... Setting up libboost-iostreams1.83-dev:amd64 (1.83.0-1ubuntu3) ... Setting up debhelper (13.11.8ubuntu1) ... Setting up libboost-iostreams-dev:amd64 (1.83.0.1ubuntu2) ... Setting up sbuild-build-depends-main-dummy (0.invalid.0) ... Processing triggers for systemd (255-1ubuntu1) ... Processing triggers for libc-bin (2.38-3ubuntu1) ... +------------------------------------------------------------------------------+ | Check architectures | +------------------------------------------------------------------------------+ Arch check ok (amd64 included in any) +------------------------------------------------------------------------------+ | Build environment | +------------------------------------------------------------------------------+ Kernel: Linux 5.4.0-169-generic #187-Ubuntu SMP Thu Nov 23 14:52:28 UTC 2023 amd64 (x86_64) Toolchain package versions: binutils_2.41.50.20231214-1ubuntu1 dpkg-dev_1.22.1ubuntu5 g++-13_13.2.0-9ubuntu1 gcc-13_13.2.0-9ubuntu1 libc6-dev_2.38-3ubuntu1 libstdc++-13-dev_13.2.0-9ubuntu1 libstdc++6_13.2.0-9ubuntu1 linux-libc-dev_6.6.0-14.14 Package versions: adduser_3.137ubuntu1 advancecomp_2.5-1 apt_2.7.7 apt-utils_2.7.7 autoconf_2.71-3 automake_1:1.16.5-1.3 autopoint_0.21-14 autotools-dev_20220109.1 base-files_13ubuntu5 base-passwd_3.6.3 bash_5.2.21-2ubuntu1 bash-completion_1:2.11-8 binutils_2.41.50.20231214-1ubuntu1 binutils-common_2.41.50.20231214-1ubuntu1 binutils-x86-64-linux-gnu_2.41.50.20231214-1ubuntu1 bsdextrautils_2.39.2-6ubuntu1 bsdutils_1:2.39.2-6ubuntu1 build-essential_12.10ubuntu1 bzip2_1.0.8-5build1 ca-certificates_20230311ubuntu1 coreutils_9.4-2ubuntu1 cpp_4:13.2.0-2ubuntu1 cpp-13_13.2.0-9ubuntu1 dash_0.5.12-6ubuntu1 debconf_1.5.82 debconf-i18n_1.5.82 debhelper_13.11.8ubuntu1 debianutils_5.14 debugedit_1:5.0-5 dh-autoreconf_20 dh-strip-nondeterminism_1.13.1-1 diffutils_1:3.10-1 dpkg_1.22.1ubuntu5 dpkg-dev_1.22.1ubuntu5 dwz_0.15-1 e2fsprogs_1.47.0-2ubuntu1 fakeroot_1.32.2-1 file_1:5.45-2 findutils_4.9.0-5 fonts-font-awesome_5.0.10+really4.7.0~dfsg-4.1 g++_4:13.2.0-2ubuntu1 g++-13_13.2.0-9ubuntu1 gcc_4:13.2.0-2ubuntu1 gcc-13_13.2.0-9ubuntu1 gcc-13-base_13.2.0-9ubuntu1 gettext_0.21-14 gettext-base_0.21-14 gpg_2.2.40-1.1ubuntu1 gpg-agent_2.2.40-1.1ubuntu1 gpgconf_2.2.40-1.1ubuntu1 gpgv_2.2.40-1.1ubuntu1 grep_3.11-3 groff-base_1.23.0-3 gzip_1.12-1ubuntu1 help2man_1.49.3 hostname_3.23+nmu1ubuntu1 icu-devtools_74.2-1ubuntu1 init_1.66ubuntu1 init-system-helpers_1.66ubuntu1 intltool-debian_0.35.0+20060710.6 krb5-locales_1.20.1-5build1 libacl1_2.3.1-3 libapparmor1_4.0.0~alpha2-0ubuntu7 libapt-pkg6.0_2.7.7 libarchive-zip-perl_1.68-1 libargon2-1_0~20190702+dfsg-4 libasan8_13.2.0-9ubuntu1 libassuan0_2.5.6-1 libatomic1_13.2.0-9ubuntu1 libattr1_1:2.5.1-4 libaudit-common_1:3.1.2-1 libaudit1_1:3.1.2-1 libbinutils_2.41.50.20231214-1ubuntu1 libblkid1_2.39.2-6ubuntu1 libboost-atomic1.83-dev_1.83.0-1ubuntu3 libboost-atomic1.83.0_1.83.0-1ubuntu3 libboost-chrono-dev_1.83.0.1ubuntu2 libboost-chrono1.83-dev_1.83.0-1ubuntu3 libboost-chrono1.83.0_1.83.0-1ubuntu3 libboost-filesystem-dev_1.83.0.1ubuntu2 libboost-filesystem1.83-dev_1.83.0-1ubuntu3 libboost-filesystem1.83.0_1.83.0-1ubuntu3 libboost-iostreams-dev_1.83.0.1ubuntu2 libboost-iostreams1.83-dev_1.83.0-1ubuntu3 libboost-iostreams1.83.0_1.83.0-1ubuntu3 libboost-regex1.83-dev_1.83.0-1ubuntu3 libboost-regex1.83.0_1.83.0-1ubuntu3 libboost-system-dev_1.83.0.1ubuntu2 libboost-system1.83-dev_1.83.0-1ubuntu3 libboost-system1.83.0_1.83.0-1ubuntu3 libboost1.83-dev_1.83.0-1ubuntu3 libbrotli1_1.1.0-2 libbz2-1.0_1.0.8-5build1 libc-bin_2.38-3ubuntu1 libc-dev-bin_2.38-3ubuntu1 libc6_2.38-3ubuntu1 libc6-dev_2.38-3ubuntu1 libcap-ng0_0.8.3-3 libcap2_1:2.66-4ubuntu1 libcc1-0_13.2.0-9ubuntu1 libcom-err2_1.47.0-2ubuntu1 libcrypt-dev_1:4.4.36-2 libcrypt1_1:4.4.36-2 libcryptsetup12_2:2.6.1-5ubuntu1 libctf-nobfd0_2.41.50.20231214-1ubuntu1 libctf0_2.41.50.20231214-1ubuntu1 libcurl3-gnutls_8.4.0-2ubuntu1 libcurl4-gnutls-dev_8.4.0-2ubuntu1 libdb5.3_5.3.28+dfsg2-4 libdebconfclient0_0.271ubuntu1 libdebhelper-perl_13.11.8ubuntu1 libdeflate-dev_1.18-1 libdeflate0_1.18-1 libdevmapper1.02.1_2:1.02.185-2ubuntu1 libdpkg-perl_1.22.1ubuntu5 libdw1_0.190-1 libelf1_0.190-1 libexpat1_2.5.0-2 libext2fs2_1.47.0-2ubuntu1 libfakeroot_1.32.2-1 libfdisk1_2.39.2-6ubuntu1 libffi8_3.4.4-2 libfile-stripnondeterminism-perl_1.13.1-1 libgcc-13-dev_13.2.0-9ubuntu1 libgcc-s1_13.2.0-9ubuntu1 libgcrypt20_1.10.2-3ubuntu1 libgdbm-compat4_1.23-5 libgdbm6_1.23-5 libgmp10_2:6.3.0+dfsg-2ubuntu4 libgnutls30_3.8.1-4ubuntu6 libgomp1_13.2.0-9ubuntu1 libgpg-error-l10n_1.47-3build1 libgpg-error0_1.47-3build1 libgpm2_1.20.7-10build1 libgprofng0_2.41.50.20231214-1ubuntu1 libgssapi-krb5-2_1.20.1-5build1 libhogweed6_3.9.1-2 libhts-dev_1.18+ds-1 libhts3_1.18+ds-1 libhtscodecs2_1.6.0-1 libhwasan0_13.2.0-9ubuntu1 libicu-dev_74.2-1ubuntu1 libicu74_74.2-1ubuntu1 libidn2-0_2.3.4-1build1 libip4tc2_1.8.9-2ubuntu2 libisl23_0.26-3 libitm1_13.2.0-9ubuntu1 libjansson4_2.14-2 libjs-d3-format_1:1.4.5+~1.4.2-2 libjs-jquery_3.6.1+dfsg+~3.5.14-1 libjs-jquery-datatables_1.11.5+dfsg-2 libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-5 libjson-c5_0.17-1 libk5crypto3_1.20.1-5build1 libkeyutils1_1.6.3-2 libkmod2_30+20230601-2ubuntu1 libkrb5-3_1.20.1-5build1 libkrb5support0_1.20.1-5build1 libldap2_2.6.6+dfsg-1~exp1ubuntu1 liblocale-gettext-perl_1.07-6 liblockfile-bin_1.17-1build2 liblockfile1_1.17-1build2 liblsan0_13.2.0-9ubuntu1 liblz4-1_1.9.4-1 liblzma-dev_5.4.5-0.1 liblzma5_5.4.5-0.1 libmagic-mgc_1:5.45-2 libmagic1_1:5.45-2 libmd0_1.1.0-1 libmount1_2.39.2-6ubuntu1 libmpc3_1.3.1-1 libmpfr6_4.2.1-1 libncurses-dev_6.4+20231209-1 libncurses6_6.4+20231209-1 libncursesw6_6.4+20231209-1 libnettle8_3.9.1-2 libnghttp2-14_1.58.0-1 libnpth0_1.6-3build2 libnsl-dev_1.3.0-3 libnsl2_1.3.0-3 libnss-nis_3.1-0ubuntu6 libnss-nisplus_1.3-0ubuntu6 libp11-kit0_0.25.3-2ubuntu2 libpam-modules_1.5.2-9.1ubuntu1 libpam-modules-bin_1.5.2-9.1ubuntu1 libpam-runtime_1.5.2-9.1ubuntu1 libpam0g_1.5.2-9.1ubuntu1 libpcre2-8-0_10.42-4ubuntu1 libperl5.36_5.36.0-10ubuntu1 libpipeline1_1.5.7-1 libpng16-16_1.6.40-2 libproc2-0_2:4.0.4-2ubuntu1 libpsl5_0.21.2-1build1 libpython3-stdlib_3.11.4-5ubuntu1 libpython3.11-minimal_3.11.7-2 libpython3.11-stdlib_3.11.7-2 libquadmath0_13.2.0-9ubuntu1 libreadline8_8.2-3 librtmp1_2.4+20151223.gitfa8646d.1-2build4 libsasl2-2_2.1.28+dfsg1-4 libsasl2-modules-db_2.1.28+dfsg1-4 libseccomp2_2.5.4-2ubuntu1 libselinux1_3.5-1build2 libsemanage-common_3.5-1build1 libsemanage2_3.5-1build1 libsepol2_3.5-2 libsframe1_2.41.50.20231214-1ubuntu1 libsmartcols1_2.39.2-6ubuntu1 libsqlite3-0_3.44.2-1 libss2_1.47.0-2ubuntu1 libssh-4_0.10.5-3ubuntu1 libssl3_3.0.10-1ubuntu3 libstdc++-13-dev_13.2.0-9ubuntu1 libstdc++6_13.2.0-9ubuntu1 libsub-override-perl_0.10-1 libsystemd-shared_255-1ubuntu1 libsystemd0_255-1ubuntu1 libtasn1-6_4.19.0-3 libtext-charwidth-perl_0.04-11 libtext-iconv-perl_1.7-8 libtext-wrapi18n-perl_0.06-10 libtinfo6_6.4+20231209-1 libtirpc-common_1.3.4+ds-1 libtirpc-dev_1.3.4+ds-1 libtirpc3_1.3.4+ds-1 libtool_2.4.7-7 libtsan2_13.2.0-9ubuntu1 libubsan1_13.2.0-9ubuntu1 libuchardet0_0.0.8-1 libudev1_255-1ubuntu1 libunistring2_1.0-2 libunistring5_1.1-2 libuuid1_2.39.2-6ubuntu1 libxml2_2.9.14+dfsg-1.3build3 libxxhash0_0.8.2-2 libzstd1_1.5.5+dfsg2-2 linux-libc-dev_6.6.0-14.14 lockfile-progs_0.1.19build1 login_1:4.13+dfsg1-3ubuntu1 logsave_1.47.0-2ubuntu1 lto-disabled-list_44 m4_1.4.19-4 make_4.3-4.1build1 man-db_2.12.0-1 mawk_1.3.4.20231126-1 media-types_10.1.0 mount_2.39.2-6ubuntu1 ncurses-base_6.4+20231209-1 ncurses-bin_6.4+20231209-1 netbase_6.4 node-commander_9.4.1-1 node-d3_5.16.0+~cs5.28.10-1 node-d3-array_3.2.0+~cs5.0.6-2 node-d3-axis_1.0.12+~1.0.16-1 node-d3-brush_1.1.6+~1.1.5-1 node-d3-chord_1.0.6+~1.0.11-1 node-d3-collection_1.0.7+~1.0.10-1 node-d3-color_1.4.1+~1.4.2-1 node-d3-contour_1.3.2+~1.3.3-1 node-d3-dispatch_1.0.6+~1.0.9-1 node-d3-drag_1.2.5+~1.2.5-1 node-d3-dsv_1.2.0+~1.2.3-1 node-d3-ease_1.0.7+~1.0.11-1 node-d3-fetch_1.2.0+~1.2.2-1 node-d3-force_2.1.1+~2.1.4-1 node-d3-format_1:1.4.5+~1.4.2-2 node-d3-geo_1.12.1+~1.12.4-1 node-d3-hierarchy_1.1.9+~1.1.8-1 node-d3-interpolate_1.4.0+~1.4.2-1 node-d3-path_1.0.9+~1.0.9-1 node-d3-polygon_1.0.6+~1.0.8-1 node-d3-quadtree_1.0.7+~1.0.9-1 node-d3-queue_3.0.7-13 node-d3-random_1.1.2+~1.1.3-1 node-d3-scale_2.2.2+~2.2.6-1 node-d3-scale-chromatic_1.5.0+~1.5.1-1 node-d3-selection_1.4.1+~1.4.3-1 node-d3-shape_1.3.7+~1.3.8-1 node-d3-time_1.1.0+~1.1.1-1 node-d3-time-format_2.3.0+~2.3.1-1 node-d3-timer_1.0.10+~1.0.10-1 node-d3-transition_1.3.2+~1.3.2-1 node-d3-voronoi_1.1.4+~1.1.9-1 node-d3-zoom_1.8.3+~1.8.4-1 node-iconv-lite_0.6.3-3 node-normalize.css_8.0.1-5 node-rw_1.3.3-5 node-safe-buffer_5.2.1+~cs2.1.2-3 openssl_3.0.10-1ubuntu3 optipng_0.7.7-3 passwd_1:4.13+dfsg1-3ubuntu1 patch_2.7.6-7build2 perl_5.36.0-10ubuntu1 perl-base_5.36.0-10ubuntu1 perl-modules-5.36_5.36.0-10ubuntu1 pinentry-curses_1.2.1-3ubuntu1 pkgbinarymangler_154 po-debconf_1.0.21+nmu1 policyrcd-script-zg2_0.1-3.1 procps_2:4.0.4-2ubuntu1 psmisc_23.6-1 python3_3.11.4-5ubuntu1 python3-minimal_3.11.4-5ubuntu1 python3.11_3.11.7-2 python3.11-minimal_3.11.7-2 readline-common_8.2-3 rpcsvc-proto_1.4.2-0ubuntu6 sbuild-build-depends-main-dummy_0.invalid.0 sed_4.9-1 sensible-utils_0.0.20 systemd_255-1ubuntu1 systemd-dev_255-1ubuntu1 systemd-sysv_255-1ubuntu1 sysvinit-utils_3.08-3ubuntu1 tar_1.34+dfsg-1.2ubuntu2 tzdata_2023c-9ubuntu1 ubuntu-keyring_2023.11.28.1 usrmerge_35ubuntu1 util-linux_2.39.2-6ubuntu1 uuid-runtime_2.39.2-6ubuntu1 xz-utils_5.4.5-0.1 zlib1g_1:1.3.dfsg-3ubuntu1 zlib1g-dev_1:1.3.dfsg-3ubuntu1 +------------------------------------------------------------------------------+ | Build | +------------------------------------------------------------------------------+ Unpack source ------------- -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA512 Format: 3.0 (quilt) Source: ataqv Binary: ataqv Architecture: any Version: 1.3.1+ds-2build1 Maintainer: Debian Med Packaging Team Uploaders: Michael R. Crusoe Homepage: https://github.com/ParkerLab/ataqv/ Standards-Version: 4.6.2 Vcs-Browser: https://salsa.debian.org/med-team/ataqv Vcs-Git: https://salsa.debian.org/med-team/ataqv.git Testsuite: autopkgtest Build-Depends: debhelper-compat (= 13), libboost-filesystem-dev, libboost-iostreams-dev, libboost-system-dev, libboost-chrono-dev, libhts-dev, libncurses-dev, zlib1g-dev, libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, help2man, python3, node-d3, debhelper Package-List: ataqv deb science optional arch=any Checksums-Sha1: d2533715129c79f7bc3e11a9673efedf0348303b 4068080 ataqv_1.3.1+ds.orig.tar.xz 5e48ebbbc8ca76b80b963b3589fe7873213f9ba7 9444 ataqv_1.3.1+ds-2build1.debian.tar.xz Checksums-Sha256: 6e996bb0dfa6b92b17537af20680827fd66f5b91b2f0bb7268bf21ff1cffd939 4068080 ataqv_1.3.1+ds.orig.tar.xz dacbb4f9f6fea49df5ae166b2ce65e22cd0e7062e7d726e3abf60022c3b052bf 9444 ataqv_1.3.1+ds-2build1.debian.tar.xz Files: 2738a7faf0c6728c73c2b24fb895c2fa 4068080 ataqv_1.3.1+ds.orig.tar.xz 3514675bd186e531b8cf1278b80c41cf 9444 ataqv_1.3.1+ds-2build1.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQIzBAEBCgAdFiEEVovyKmYzfL/Jprm3LIPbyOm9DjcFAmWBsBUACgkQLIPbyOm9 Djf6txAAjizJaMiaKU6cS0mku1DjCqsjAN9AFQ1Wl6CIbKc5YOkwNlCGJBdIYNCa PFCL0A6VnzdWOPnpsQh5hT3Bo8EEgGUZgqjej2ibC6Icqff8IJVK7vTLiIz2iUKM P46MHimEtGzbJOs3+XG3Vsl7UJXfoVAKpZNc9kZ322Y6QPTh+MC2C2qdsGdzmxb8 8buMexbrQ/akjXwdpdpjALUz2EKEZOs+XVkQQz/fKxMm79XLusinAOklpN47woNR I3vQoprPh9DoCTHCW6ty+V++V7hy2oZzFAa9BWk0D+TVeyA9PdkxaGFALdA2GLMR dQaypbKiNXVek1X8PJYommdQwe/iRYFRC0K+V7ih7ad8HbtbZamJVX+0WWO5ZLGk gRudt7t7qlBHJ6llIr+KSCx6AeohJKUFq3vtVugyuXyCZwcCDFzAJcNbXaq8WPQT JELmGhky6oBmOd/KZckE5OWzkvqUc2QnPF9d+hjT399fGr/rdsFIfuBjlnIDRyhr wqNLnv1ANjycbzkBspf7RzoRwIjRBGLgH6kaiwPCcwD/QomDTD3+DqZQRYUczHpx HrxZWYZtWCqTKDp8AxJLk8vlskz/zXd8hFCFTsoLHNmmOMeLIGzCmIzHroj0t0IT Wsm3h/aogP3PPXuGyqkuEpWo9lfREMB68rMkFH5xXvYzXLQ9g/0= =sU2z -----END PGP SIGNATURE----- gpgv: Signature made Tue Dec 19 15:00:37 2023 UTC gpgv: using RSA key 568BF22A66337CBFC9A6B9B72C83DBC8E9BD0E37 gpgv: Can't check signature: No public key dpkg-source: warning: cannot verify inline signature for ./ataqv_1.3.1+ds-2build1.dsc: no acceptable signature found dpkg-source: info: extracting ataqv in /<> dpkg-source: info: unpacking ataqv_1.3.1+ds.orig.tar.xz dpkg-source: info: unpacking ataqv_1.3.1+ds-2build1.debian.tar.xz dpkg-source: info: using patch list from debian/patches/series dpkg-source: info: applying modernize dpkg-source: info: applying no_cov dpkg-source: info: applying python3 dpkg-source: info: applying packaged_js dpkg-source: info: applying spelling dpkg-source: info: applying clean_less dpkg-source: info: applying reproducible_build Check disk space ---------------- Sufficient free space for build User Environment ---------------- APT_CONFIG=/var/lib/sbuild/apt.conf DEB_BUILD_OPTIONS=parallel=4 HOME=/sbuild-nonexistent LANG=C.UTF-8 LC_ALL=C.UTF-8 LOGNAME=buildd PATH=/usr/local/sbin:/usr/local/bin:/usr/sbin:/usr/bin:/sbin:/bin:/usr/games SCHROOT_ALIAS_NAME=build-PACKAGEBUILD-27576134 SCHROOT_CHROOT_NAME=build-PACKAGEBUILD-27576134 SCHROOT_COMMAND=env SCHROOT_GID=2501 SCHROOT_GROUP=buildd SCHROOT_SESSION_ID=build-PACKAGEBUILD-27576134 SCHROOT_UID=2001 SCHROOT_USER=buildd SHELL=/bin/sh TERM=unknown USER=buildd V=1 dpkg-buildpackage ----------------- Command: dpkg-buildpackage -us -uc -mLaunchpad Build Daemon -b -rfakeroot dpkg-buildpackage: info: source package ataqv dpkg-buildpackage: info: source version 1.3.1+ds-2build1 dpkg-buildpackage: info: source distribution noble dpkg-source --before-build . dpkg-buildpackage: info: host architecture amd64 debian/rules clean dh clean dh_auto_clean make -j4 clean make[1]: Entering directory '/<>' make[1]: Leaving directory '/<>' dh_clean debian/rules binary dh binary dh_update_autotools_config dh_autoreconf debian/rules override_dh_auto_configure make[1]: Entering directory '/<>' cp -sf /usr/share/nodejs/d3/dist/d3.min.js src/web/js/d3.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/JSZip/jszip.min.js src/web/js/jszip.min.js cp -sf /usr/share/javascript/jquery-datatables-extensions/Buttons/css/buttons.dataTables.min.css src/web/css/datatables.buttons.min.css cp -sf /usr/share/javascript/jquery-datatables/css/jquery.dataTables.min.css src/web/css/datatables.min.css cp -sf /usr/share/fonts-font-awesome/css/font-awesome.min.css src/web/css/font-awesome.min.css cp -sf /usr/share/javascript/normalize.css/normalize.css src/web/css/normalize.css cp -sf /usr/share/fonts-font-awesome/fonts/* src/web/fonts/ cp -s /usr/share/javascript/jquery/jquery.min.js \ /usr/share/javascript/jquery-datatables-extensions/pdfmake/build/pdfmake.min.js \ /usr/share/javascript/jquery-datatables/jquery.dataTables.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/dataTables.buttons.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.colVis.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.html5.min.js \ /usr/share/javascript/jquery-datatables-extensions/Buttons/js/buttons.print.min.js \ /usr/share/javascript/jquery-datatables-extensions/Responsive/js/dataTables.responsive.min.js \ src/web/js/ rm -f src/web/js/datatables.min.js make[1]: Leaving directory '/<>' debian/rules override_dh_auto_build make[1]: Entering directory '/<>' dh_auto_build -- all testing/run_ataqv_tests make -j4 "INSTALL=install --strip-program=true" all testing/run_ataqv_tests make[2]: Entering directory '/<>' g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o build/ataqv.o -c /<>/src/cpp/ataqv.cpp g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o build/Features.o -c /<>/src/cpp/Features.cpp g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o build/HTS.o -c /<>/src/cpp/HTS.cpp g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o build/IO.o -c /<>/src/cpp/IO.cpp g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o build/Metrics.o -c /<>/src/cpp/Metrics.cpp g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o build/Peaks.o -c /<>/src/cpp/Peaks.cpp g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o build/Utils.o -c /<>/src/cpp/Utils.cpp g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o testing/run_ataqv_tests.o -c /<>/src/cpp/run_ataqv_tests.cpp g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o testing/test_features.o -c /<>/src/cpp/test_features.cpp In file included from /<>/src/cpp/test_features.cpp:1: /<>/src/cpp/test_features.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____167()’: /<>/src/cpp/test_features.cpp:171:47: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] 171 | REQUIRE_THROWS_AS(collection.add(f), std::out_of_range); | ^~~~~~~~~~~~ g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o testing/test_hts.o -c /<>/src/cpp/test_hts.cpp In file included from /<>/src/cpp/test_hts.cpp:3: /<>/src/cpp/test_hts.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____169()’: /<>/src/cpp/test_hts.cpp:200:57: warning: catching polymorphic type ‘class HTSException’ by value [-Wcatch-value=] 200 | REQUIRE_THROWS_AS(record_to_string(header, record), HTSException); | ^~~~~~~~~~~~ g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o testing/test_io.o -c /<>/src/cpp/test_io.cpp g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o testing/test_metrics.o -c /<>/src/cpp/test_metrics.cpp In file included from /<>/src/cpp/test_metrics.cpp:3: /<>/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____170()’: /<>/src/cpp/test_metrics.cpp:173:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 173 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /<>/src/cpp/test_metrics.cpp:178:56: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 178 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /<>/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____243()’: /<>/src/cpp/test_metrics.cpp:249:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 249 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ /<>/src/cpp/test_metrics.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____252()’: /<>/src/cpp/test_metrics.cpp:259:52: warning: catching polymorphic type ‘class FileException’ by value [-Wcatch-value=] 259 | REQUIRE_THROWS_AS(collector.load_alignments(), FileException); | ^~~~~~~~~~~~~ g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o testing/test_peaks.o -c /<>/src/cpp/test_peaks.cpp In file included from /<>/src/cpp/test_peaks.cpp:1: /<>/src/cpp/test_peaks.cpp: In function ‘void ____C_A_T_C_H____T_E_S_T____172()’: /<>/src/cpp/test_peaks.cpp:181:44: warning: catching polymorphic type ‘class std::out_of_range’ by value [-Wcatch-value=] 181 | REQUIRE_THROWS_AS(rpc.add(peak3), std::out_of_range); | ^~~~~~~~~~~~ In file included from /usr/include/c++/13/bits/stl_pair.h:61, from /usr/include/c++/13/tuple:38, from /usr/include/c++/13/mutex:40, from /usr/include/c++/13/future:40, from /<>/src/cpp/Metrics.cpp:10: In function ‘std::swap, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value&, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value&)std::enable_if, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value> >, std::is_move_constructible, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value>, std::is_move_assignable, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value> >::value, void>::type’, inlined from ‘nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::operator=(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>)’ at /<>/src/cpp/json.hpp:2554:13, inlined from ‘nlohmann::detail::external_constructor<(nlohmann::detail::value_t)7>::construct, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::number_float_t)void’ at /<>/src/cpp/json.hpp:277:15: /usr/include/c++/13/bits/move.h:198:7: warning: ‘MEM[(union json_value &)&D.339503 + 8]’ may be used uninitialized [-Wmaybe-uninitialized] 198 | __a = _GLIBCXX_MOVE(__b); | ^~~ In file included from /<>/src/cpp/Metrics.hpp:16, from /<>/src/cpp/Metrics.cpp:21: /<>/src/cpp/json.hpp: In function ‘nlohmann::detail::external_constructor<(nlohmann::detail::value_t)7>::construct, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::number_float_t)void’: /<>/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::swap, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value&, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value&)std::enable_if, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value> >, std::is_move_constructible, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value>, std::is_move_assignable, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value> >::value, void>::type’, inlined from ‘nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::operator=(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>)’ at /<>/src/cpp/json.hpp:2554:13, inlined from ‘nlohmann::detail::external_constructor<(nlohmann::detail::value_t)7>::construct, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::number_float_t)void’ at /<>/src/cpp/json.hpp:277:15, inlined from ‘nlohmann::detail::to_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, long double, 0>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, long double)void’ at /<>/src/cpp/json.hpp:545:59, inlined from ‘nlohmann::detail::to_json_fn::call, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, long double const&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, long double const&, nlohmann::detail::priority_tag<1u>) constdecltype ((to_json({parm#1}, (forward)({parm#2}))),((void)()))’ at /<>/src/cpp/json.hpp:837:23, inlined from ‘nlohmann::detail::to_json_fn::operator(), std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, long double const&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, long double const&) constvoid’ at /<>/src/cpp/json.hpp:852:20, inlined from ‘nlohmann::adl_serializer::to_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, long double const&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, long double const&)void’ at /<>/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::basic_json(long double const&)’ at /<>/src/cpp/json.hpp:2009:35, inlined from ‘std::_Construct, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, long double const&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*, long double const&)void’ at /usr/include/c++/13/bits/stl_construct.h:119:7, inlined from ‘std::__do_uninit_copy<__gnu_cxx::__normal_iterator > >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*>(__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*)nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*’ at /usr/include/c++/13/bits/stl_uninitialized.h:120:21, inlined from ‘std::__uninitialized_copy::__uninit_copy<__gnu_cxx::__normal_iterator > >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*>(__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*)nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*’ at /usr/include/c++/13/bits/stl_uninitialized.h:137:32, inlined from ‘std::uninitialized_copy<__gnu_cxx::__normal_iterator > >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*>(__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*)nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*’ at /usr/include/c++/13/bits/stl_uninitialized.h:185:15, inlined from ‘std::__uninitialized_copy_a<__gnu_cxx::__normal_iterator > >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >(__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >&)nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*’ at /usr/include/c++/13/bits/stl_uninitialized.h:373:37, inlined from ‘std::vector, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >::_M_range_initialize<__gnu_cxx::__normal_iterator > > >(__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >, std::forward_iterator_tag)void’ at /usr/include/c++/13/bits/stl_vector.h:1692:33, inlined from ‘std::vector, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >::vector<__gnu_cxx::__normal_iterator > >, void>(__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > const&)’ at /usr/include/c++/13/bits/stl_vector.h:708:23, inlined from ‘std::__new_allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >::construct, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, __gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > > >(std::vector, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >*, __gnu_cxx::__normal_iterator > >&&, __gnu_cxx::__normal_iterator > >&&)void’ at /usr/include/c++/13/bits/new_allocator.h:191:4, inlined from ‘nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::create, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, __gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > > >(__gnu_cxx::__normal_iterator > >&&, __gnu_cxx::__normal_iterator > >&&)std::vector, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >*’ at /<>/src/cpp/json.hpp:1634:24, inlined from ‘nlohmann::detail::external_constructor<(nlohmann::detail::value_t)2>::construct, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::vector >, 0>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::vector > const&)void’ at /<>/src/cpp/json.hpp:332:77, inlined from ‘nlohmann::detail::to_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::vector >, 0>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::vector > const&)void’ at /<>/src/cpp/json.hpp:581:52, inlined from ‘nlohmann::detail::to_json_fn::call, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::vector > const&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::vector > const&, nlohmann::detail::priority_tag<1u>) constdecltype ((to_json({parm#1}, (forward > const&>)({parm#2}))),((void)()))’ at /<>/src/cpp/json.hpp:837:23, inlined from ‘nlohmann::detail::to_json_fn::operator(), std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::vector > const&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::vector > const&) constvoid’ at /<>/src/cpp/json.hpp:852:20, inlined from ‘nlohmann::adl_serializer >, void>::to_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::vector > const&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::vector > const&)void’ at /<>/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::basic_json > const&, std::vector >, 0>(std::vector > const&)’ at /<>/src/cpp/json.hpp:2009:35, inlined from ‘std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >::pair, std::allocator > const, std::vector >, true>(std::pair, std::allocator > const, std::vector > > const&)’ at /usr/include/c++/13/bits/stl_pair.h:586:22, inlined from ‘std::__new_allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >::construct, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::pair, std::allocator > const, std::vector > > const&>(std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >*, std::pair, std::allocator > const, std::vector > > const&)void’ at /usr/include/c++/13/bits/new_allocator.h:191:4, inlined from ‘std::allocator_traits, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > > >::construct, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::pair, std::allocator > const, std::vector > > const&>(std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >&, std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >*, std::pair, std::allocator > const, std::vector > > const&)void’ at /usr/include/c++/13/bits/alloc_traits.h:538:17, inlined from ‘std::_Rb_tree, std::allocator >, std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::_Select1st, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >::_M_construct_node, std::allocator > const, std::vector > > const&>(std::_Rb_tree_node, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >*, std::pair, std::allocator > const, std::vector > > const&)void’ at /usr/include/c++/13/bits/stl_tree.h:597:32, inlined from ‘std::_Rb_tree, std::allocator >, std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::_Select1st, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >::_M_create_node, std::allocator > const, std::vector > > const&>(std::pair, std::allocator > const, std::vector > > const&)std::_Rb_tree_node, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >*’ at /usr/include/c++/13/bits/stl_tree.h:614:21, inlined from ‘std::_Rb_tree, std::allocator >, std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::_Select1st, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >::_Auto_node::_Auto_node, std::allocator > const, std::vector > > const&>(std::_Rb_tree, std::allocator >, std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::_Select1st, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >&, std::pair, std::allocator > const, std::vector > > const&)’ at /usr/include/c++/13/bits/stl_tree.h:1637:32, inlined from ‘std::_Rb_tree, std::allocator >, std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::_Select1st, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >::_M_emplace_unique, std::allocator > const, std::vector > > const&>(std::pair, std::allocator > const, std::vector > > const&)std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, bool>’ at /usr/include/c++/13/bits/stl_tree.h:2434:13, inlined from ‘std::_Rb_tree, std::allocator >, std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::_Select1st, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >::_M_insert_range_unique, std::allocator > const, std::vector > > > >(std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >)std::enable_if, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::iterator_traits, std::allocator > const, std::vector > > > >::value_type>::value, void>::type’ at /usr/include/c++/13/bits/stl_tree.h:1112:23, inlined from ‘std::map, std::allocator >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >::map, std::allocator > const, std::vector > > > >(std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >)’ at /usr/include/c++/13/bits/stl_map.h:287:31, inlined from ‘std::__new_allocator, std::allocator >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > > >::construct, std::allocator >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > > >(std::map, std::allocator >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >*, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >&&, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >&&)void’ at /usr/include/c++/13/bits/new_allocator.h:191:4, inlined from ‘nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::create, std::allocator >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > > >(std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >&&, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >&&)std::map, std::allocator >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >*’ at /<>/src/cpp/json.hpp:1634:24, inlined from ‘nlohmann::detail::external_constructor<(nlohmann::detail::value_t)1>::construct, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >, 0>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > > const&)void’ at /<>/src/cpp/json.hpp:358:79, inlined from ‘nlohmann::detail::to_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >, 0>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > > const&)void’ at /<>/src/cpp/json.hpp:590:53, inlined from ‘nlohmann::detail::to_json_fn::call, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&, nlohmann::detail::priority_tag<1u>) constdecltype ((to_json({parm#1}, (forward, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&>)({parm#2}))),((void)()))’ at /<>/src/cpp/json.hpp:837:23, inlined from ‘nlohmann::detail::to_json_fn::operator(), std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&) constvoid’ at /<>/src/cpp/json.hpp:852:20, inlined from ‘nlohmann::adl_serializer, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >, void>::to_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&)void’ at /<>/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::basic_json, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >, 0>(std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&)’ at /<>/src/cpp/json.hpp:2009:35, inlined from ‘Metrics::to_json[abi:cxx11]()’ at /<>/src/cpp/Metrics.cpp:1570:1: /usr/include/c++/13/bits/move.h:198:7: warning: ‘MEM[(union json_value &)&D.467408 + 8]’ may be used uninitialized [-Wmaybe-uninitialized] 198 | __a = _GLIBCXX_MOVE(__b); | ^~~ /<>/src/cpp/json.hpp: In member function ‘Metrics::to_json[abi:cxx11]()’: /<>/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o testing/test_utils.o -c /<>/src/cpp/test_utils.cpp g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o testing/Features.o -c /<>/src/cpp/Features.cpp g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o testing/HTS.o -c /<>/src/cpp/HTS.cpp g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o testing/IO.o -c /<>/src/cpp/IO.cpp g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o testing/Metrics.o -c /<>/src/cpp/Metrics.cpp g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o testing/Peaks.o -c /<>/src/cpp/Peaks.cpp g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o testing/Utils.o -c /<>/src/cpp/Utils.cpp g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o build/ataqv build/ataqv.o build/Features.o build/HTS.o build/IO.o build/Metrics.o build/Peaks.o build/Utils.o -Wl,-Bsymbolic-functions -flto=auto -ffat-lto-objects -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread In function ‘swap’, inlined from ‘operator=’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:2554:13, inlined from ‘construct’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:277:15: /usr/include/c++/13/bits/move.h:198:7: warning: ‘MEM[(union json_value &)&D.28578 + 8]’ may be used uninitialized [-Wmaybe-uninitialized] 198 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp: In function ‘construct’: /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:277:15: note: ‘’ declared here In function ‘swap’, inlined from ‘operator=’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:2554:13, inlined from ‘construct’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:277:15, inlined from ‘to_json’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:545:59, inlined from ‘call’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:837:23, inlined from ‘operator()’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:852:20, inlined from ‘to_json’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:942:28, inlined from ‘__ct ’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:2009:35, inlined from ‘_Construct’ at /usr/include/c++/13/bits/stl_construct.h:119:7, inlined from ‘__do_uninit_copy’ at /usr/include/c++/13/bits/stl_uninitialized.h:120:21, inlined from ‘__uninit_copy’ at /usr/include/c++/13/bits/stl_uninitialized.h:137:32, inlined from ‘uninitialized_copy’ at /usr/include/c++/13/bits/stl_uninitialized.h:185:15, inlined from ‘__uninitialized_copy_a’ at /usr/include/c++/13/bits/stl_uninitialized.h:373:37, inlined from ‘_M_range_initialize’ at /usr/include/c++/13/bits/stl_vector.h:1692:33, inlined from ‘__ct ’ at /usr/include/c++/13/bits/stl_vector.h:708:23, inlined from ‘construct’ at /usr/include/c++/13/bits/new_allocator.h:191:4, inlined from ‘create’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:1634:24, inlined from ‘construct’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:332:77, inlined from ‘to_json’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:581:52, inlined from ‘call’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:837:23, inlined from ‘operator()’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:852:20, inlined from ‘to_json’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:942:28, inlined from ‘__ct ’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:2009:35, inlined from ‘__ct ’ at /usr/include/c++/13/bits/stl_pair.h:586:22, inlined from ‘construct’ at /usr/include/c++/13/bits/new_allocator.h:191:4, inlined from ‘construct’ at /usr/include/c++/13/bits/alloc_traits.h:538:17, inlined from ‘_M_construct_node’ at /usr/include/c++/13/bits/stl_tree.h:597:32, inlined from ‘_M_create_node’ at /usr/include/c++/13/bits/stl_tree.h:614:21, inlined from ‘__ct ’ at /usr/include/c++/13/bits/stl_tree.h:1637:32, inlined from ‘_M_emplace_unique’ at /usr/include/c++/13/bits/stl_tree.h:2434:13, inlined from ‘_M_insert_range_unique’ at /usr/include/c++/13/bits/stl_tree.h:1112:23, inlined from ‘__ct ’ at /usr/include/c++/13/bits/stl_map.h:287:31, inlined from ‘construct’ at /usr/include/c++/13/bits/new_allocator.h:191:4, inlined from ‘create’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:1634:24, inlined from ‘construct’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:358:79, inlined from ‘to_json’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:590:53, inlined from ‘call’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:837:23, inlined from ‘operator()’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:852:20, inlined from ‘to_json’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:942:28, inlined from ‘__ct ’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:2009:35, inlined from ‘to_json’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/Metrics.cpp:1570:1: /usr/include/c++/13/bits/move.h:198:7: warning: ‘MEM[(union json_value &)&D.43910 + 8]’ may be used uninitialized [-Wmaybe-uninitialized] 198 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp: In member function ‘to_json’: /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:277:15: note: ‘’ declared here In file included from /usr/include/c++/13/bits/stl_pair.h:61, from /usr/include/c++/13/tuple:38, from /usr/include/c++/13/mutex:40, from /usr/include/c++/13/future:40, from /<>/src/cpp/Metrics.cpp:10: In function ‘std::swap, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value&, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value&)std::enable_if, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value> >, std::is_move_constructible, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value>, std::is_move_assignable, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value> >::value, void>::type’, inlined from ‘nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::operator=(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>)’ at /<>/src/cpp/json.hpp:2554:13, inlined from ‘nlohmann::detail::external_constructor<(nlohmann::detail::value_t)7>::construct, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::number_float_t)void’ at /<>/src/cpp/json.hpp:277:15: /usr/include/c++/13/bits/move.h:198:7: warning: ‘MEM[(union json_value &)&D.339503 + 8]’ may be used uninitialized [-Wmaybe-uninitialized] 198 | __a = _GLIBCXX_MOVE(__b); | ^~~ In file included from /<>/src/cpp/Metrics.hpp:16, from /<>/src/cpp/Metrics.cpp:21: /<>/src/cpp/json.hpp: In function ‘nlohmann::detail::external_constructor<(nlohmann::detail::value_t)7>::construct, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::number_float_t)void’: /<>/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ In function ‘std::swap, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value&, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value&)std::enable_if, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value> >, std::is_move_constructible, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value>, std::is_move_assignable, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::json_value> >::value, void>::type’, inlined from ‘nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::operator=(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>)’ at /<>/src/cpp/json.hpp:2554:13, inlined from ‘nlohmann::detail::external_constructor<(nlohmann::detail::value_t)7>::construct, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::number_float_t)void’ at /<>/src/cpp/json.hpp:277:15, inlined from ‘nlohmann::detail::to_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, long double, 0>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, long double)void’ at /<>/src/cpp/json.hpp:545:59, inlined from ‘nlohmann::detail::to_json_fn::call, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, long double const&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, long double const&, nlohmann::detail::priority_tag<1u>) constdecltype ((to_json({parm#1}, (forward)({parm#2}))),((void)()))’ at /<>/src/cpp/json.hpp:837:23, inlined from ‘nlohmann::detail::to_json_fn::operator(), std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, long double const&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, long double const&) constvoid’ at /<>/src/cpp/json.hpp:852:20, inlined from ‘nlohmann::adl_serializer::to_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, long double const&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, long double const&)void’ at /<>/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::basic_json(long double const&)’ at /<>/src/cpp/json.hpp:2009:35, inlined from ‘std::_Construct, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, long double const&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*, long double const&)void’ at /usr/include/c++/13/bits/stl_construct.h:119:7, inlined from ‘std::__do_uninit_copy<__gnu_cxx::__normal_iterator > >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*>(__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*)nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*’ at /usr/include/c++/13/bits/stl_uninitialized.h:120:21, inlined from ‘std::__uninitialized_copy::__uninit_copy<__gnu_cxx::__normal_iterator > >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*>(__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*)nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*’ at /usr/include/c++/13/bits/stl_uninitialized.h:137:32, inlined from ‘std::uninitialized_copy<__gnu_cxx::__normal_iterator > >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*>(__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*)nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*’ at /usr/include/c++/13/bits/stl_uninitialized.h:185:15, inlined from ‘std::__uninitialized_copy_a<__gnu_cxx::__normal_iterator > >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >(__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >&)nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>*’ at /usr/include/c++/13/bits/stl_uninitialized.h:373:37, inlined from ‘std::vector, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >::_M_range_initialize<__gnu_cxx::__normal_iterator > > >(__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >, std::forward_iterator_tag)void’ at /usr/include/c++/13/bits/stl_vector.h:1692:33, inlined from ‘std::vector, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >::vector<__gnu_cxx::__normal_iterator > >, void>(__gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > >, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > const&)’ at /usr/include/c++/13/bits/stl_vector.h:708:23, inlined from ‘std::__new_allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >::construct, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, __gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > > >(std::vector, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >*, __gnu_cxx::__normal_iterator > >&&, __gnu_cxx::__normal_iterator > >&&)void’ at /usr/include/c++/13/bits/new_allocator.h:191:4, inlined from ‘nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::create, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, __gnu_cxx::__normal_iterator > >, __gnu_cxx::__normal_iterator > > >(__gnu_cxx::__normal_iterator > >&&, __gnu_cxx::__normal_iterator > >&&)std::vector, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::allocator, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >*’ at /<>/src/cpp/json.hpp:1634:24, inlined from ‘nlohmann::detail::external_constructor<(nlohmann::detail::value_t)2>::construct, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::vector >, 0>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::vector > const&)void’ at /<>/src/cpp/json.hpp:332:77, inlined from ‘nlohmann::detail::to_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::vector >, 0>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::vector > const&)void’ at /<>/src/cpp/json.hpp:581:52, inlined from ‘nlohmann::detail::to_json_fn::call, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::vector > const&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::vector > const&, nlohmann::detail::priority_tag<1u>) constdecltype ((to_json({parm#1}, (forward > const&>)({parm#2}))),((void)()))’ at /<>/src/cpp/json.hpp:837:23, inlined from ‘nlohmann::detail::to_json_fn::operator(), std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::vector > const&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::vector > const&) constvoid’ at /<>/src/cpp/json.hpp:852:20, inlined from ‘nlohmann::adl_serializer >, void>::to_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::vector > const&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::vector > const&)void’ at /<>/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::basic_json > const&, std::vector >, 0>(std::vector > const&)’ at /<>/src/cpp/json.hpp:2009:35, inlined from ‘std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >::pair, std::allocator > const, std::vector >, true>(std::pair, std::allocator > const, std::vector > > const&)’ at /usr/include/c++/13/bits/stl_pair.h:586:22, inlined from ‘std::__new_allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >::construct, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::pair, std::allocator > const, std::vector > > const&>(std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >*, std::pair, std::allocator > const, std::vector > > const&)void’ at /usr/include/c++/13/bits/new_allocator.h:191:4, inlined from ‘std::allocator_traits, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > > >::construct, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::pair, std::allocator > const, std::vector > > const&>(std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >&, std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >*, std::pair, std::allocator > const, std::vector > > const&)void’ at /usr/include/c++/13/bits/alloc_traits.h:538:17, inlined from ‘std::_Rb_tree, std::allocator >, std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::_Select1st, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >::_M_construct_node, std::allocator > const, std::vector > > const&>(std::_Rb_tree_node, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >*, std::pair, std::allocator > const, std::vector > > const&)void’ at /usr/include/c++/13/bits/stl_tree.h:597:32, inlined from ‘std::_Rb_tree, std::allocator >, std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::_Select1st, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >::_M_create_node, std::allocator > const, std::vector > > const&>(std::pair, std::allocator > const, std::vector > > const&)std::_Rb_tree_node, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >*’ at /usr/include/c++/13/bits/stl_tree.h:614:21, inlined from ‘std::_Rb_tree, std::allocator >, std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::_Select1st, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >::_Auto_node::_Auto_node, std::allocator > const, std::vector > > const&>(std::_Rb_tree, std::allocator >, std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::_Select1st, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >&, std::pair, std::allocator > const, std::vector > > const&)’ at /usr/include/c++/13/bits/stl_tree.h:1637:32, inlined from ‘std::_Rb_tree, std::allocator >, std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::_Select1st, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >::_M_emplace_unique, std::allocator > const, std::vector > > const&>(std::pair, std::allocator > const, std::vector > > const&)std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, bool>’ at /usr/include/c++/13/bits/stl_tree.h:2434:13, inlined from ‘std::_Rb_tree, std::allocator >, std::pair, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::_Select1st, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > >, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >::_M_insert_range_unique, std::allocator > const, std::vector > > > >(std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >)std::enable_if, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> >, std::iterator_traits, std::allocator > const, std::vector > > > >::value_type>::value, void>::type’ at /usr/include/c++/13/bits/stl_tree.h:1112:23, inlined from ‘std::map, std::allocator >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >::map, std::allocator > const, std::vector > > > >(std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >)’ at /usr/include/c++/13/bits/stl_map.h:287:31, inlined from ‘std::__new_allocator, std::allocator >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > > >::construct, std::allocator >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > > >(std::map, std::allocator >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >*, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >&&, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >&&)void’ at /usr/include/c++/13/bits/new_allocator.h:191:4, inlined from ‘nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::create, std::allocator >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > > >(std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >&&, std::_Rb_tree_const_iterator, std::allocator > const, std::vector > > >&&)std::map, std::allocator >, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::less, std::allocator > >, std::allocator, std::allocator > const, nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer> > > >*’ at /<>/src/cpp/json.hpp:1634:24, inlined from ‘nlohmann::detail::external_constructor<(nlohmann::detail::value_t)1>::construct, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >, 0>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > > const&)void’ at /<>/src/cpp/json.hpp:358:79, inlined from ‘nlohmann::detail::to_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >, 0>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > > const&)void’ at /<>/src/cpp/json.hpp:590:53, inlined from ‘nlohmann::detail::to_json_fn::call, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&, nlohmann::detail::priority_tag<1u>) constdecltype ((to_json({parm#1}, (forward, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&>)({parm#2}))),((void)()))’ at /<>/src/cpp/json.hpp:837:23, inlined from ‘nlohmann::detail::to_json_fn::operator(), std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&) constvoid’ at /<>/src/cpp/json.hpp:852:20, inlined from ‘nlohmann::adl_serializer, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >, void>::to_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&>(nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>&, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&)void’ at /<>/src/cpp/json.hpp:942:28, inlined from ‘nlohmann::basic_json, std::allocator >, bool, long, unsigned long, double, std::allocator, nlohmann::adl_serializer>::basic_json, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&, std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >, 0>(std::map, std::allocator >, std::vector >, std::less, std::allocator > >, std::allocator, std::allocator > const, std::vector > > > >&)’ at /<>/src/cpp/json.hpp:2009:35, inlined from ‘Metrics::to_json[abi:cxx11]()’ at /<>/src/cpp/Metrics.cpp:1570:1: /usr/include/c++/13/bits/move.h:198:7: warning: ‘MEM[(union json_value &)&D.467408 + 8]’ may be used uninitialized [-Wmaybe-uninitialized] 198 | __a = _GLIBCXX_MOVE(__b); | ^~~ /<>/src/cpp/json.hpp: In member function ‘Metrics::to_json[abi:cxx11]()’: /<>/src/cpp/json.hpp:277:15: note: ‘’ declared here 277 | j = BasicJsonType{}; | ~~^~~~~~~~~~~~~~~~~ g++ -g -O2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -ffile-prefix-map=/<>=. -flto=auto -ffat-lto-objects -fstack-protector-strong -fstack-clash-protection -Wformat -Werror=format-security -fcf-protection -fdebug-prefix-map=/<>=/usr/src/ataqv-1.3.1+ds-2build1 -std=c++11 -pthread -O3 -g -Wdate-time -D_FORTIFY_SOURCE=3 -pedantic -Wall -Wextra -Wwrite-strings -Wstrict-overflow -fno-strict-aliasing -fPIC -I/<>/src/cpp -D AMD64 -D LINUX -o testing/run_ataqv_tests testing/run_ataqv_tests.o testing/test_features.o testing/test_hts.o testing/test_io.o testing/test_metrics.o testing/test_peaks.o testing/test_utils.o testing/Features.o testing/HTS.o testing/IO.o testing/Metrics.o testing/Peaks.o testing/Utils.o -Wl,-Bsymbolic-functions -flto=auto -ffat-lto-objects -Wl,-z,relro -Wl,-z,now -lboost_filesystem -lboost_iostreams -lboost_system -lboost_chrono -lhts -lz -lncurses -lpthread In function ‘swap’, inlined from ‘operator=’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:2554:13, inlined from ‘construct’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:277:15: /usr/include/c++/13/bits/move.h:198:7: warning: ‘MEM[(union json_value &)&D.11190 + 8]’ may be used uninitialized [-Wmaybe-uninitialized] 198 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp: In function ‘construct’: /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:277:15: note: ‘’ declared here In function ‘swap’, inlined from ‘operator=’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:2554:13, inlined from ‘construct’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:277:15, inlined from ‘to_json’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:545:59, inlined from ‘call’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:837:23, inlined from ‘operator()’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:852:20, inlined from ‘to_json’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:942:28, inlined from ‘__ct ’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:2009:35, inlined from ‘_Construct’ at /usr/include/c++/13/bits/stl_construct.h:119:7, inlined from ‘__do_uninit_copy’ at /usr/include/c++/13/bits/stl_uninitialized.h:120:21, inlined from ‘__uninit_copy’ at /usr/include/c++/13/bits/stl_uninitialized.h:137:32, inlined from ‘uninitialized_copy’ at /usr/include/c++/13/bits/stl_uninitialized.h:185:15, inlined from ‘__uninitialized_copy_a’ at /usr/include/c++/13/bits/stl_uninitialized.h:373:37, inlined from ‘_M_range_initialize’ at /usr/include/c++/13/bits/stl_vector.h:1692:33, inlined from ‘__ct ’ at /usr/include/c++/13/bits/stl_vector.h:708:23, inlined from ‘construct’ at /usr/include/c++/13/bits/new_allocator.h:191:4, inlined from ‘create’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:1634:24, inlined from ‘construct’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:332:77, inlined from ‘to_json’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:581:52, inlined from ‘call’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:837:23, inlined from ‘operator()’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:852:20, inlined from ‘to_json’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:942:28, inlined from ‘__ct ’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:2009:35, inlined from ‘__ct ’ at /usr/include/c++/13/bits/stl_pair.h:586:22, inlined from ‘construct’ at /usr/include/c++/13/bits/new_allocator.h:191:4, inlined from ‘construct’ at /usr/include/c++/13/bits/alloc_traits.h:538:17, inlined from ‘_M_construct_node’ at /usr/include/c++/13/bits/stl_tree.h:597:32, inlined from ‘_M_create_node’ at /usr/include/c++/13/bits/stl_tree.h:614:21, inlined from ‘__ct ’ at /usr/include/c++/13/bits/stl_tree.h:1637:32, inlined from ‘_M_emplace_unique’ at /usr/include/c++/13/bits/stl_tree.h:2434:13, inlined from ‘_M_insert_range_unique’ at /usr/include/c++/13/bits/stl_tree.h:1112:23, inlined from ‘__ct ’ at /usr/include/c++/13/bits/stl_map.h:287:31, inlined from ‘construct’ at /usr/include/c++/13/bits/new_allocator.h:191:4, inlined from ‘create’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:1634:24, inlined from ‘construct’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:358:79, inlined from ‘to_json’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:590:53, inlined from ‘call’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:837:23, inlined from ‘operator()’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:852:20, inlined from ‘to_json’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:942:28, inlined from ‘__ct ’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:2009:35, inlined from ‘to_json’ at /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/Metrics.cpp:1570:1: /usr/include/c++/13/bits/move.h:198:7: warning: ‘MEM[(union json_value &)&D.31597 + 8]’ may be used uninitialized [-Wmaybe-uninitialized] 198 | __a = _GLIBCXX_MOVE(__b); | ^ /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp: In member function ‘to_json’: /usr/src/ataqv-1.3.1+ds-2build1/src/cpp/json.hpp:277:15: note: ‘’ declared here make[2]: Leaving directory '/<>' make[1]: Leaving directory '/<>' dh_auto_test make -j4 test make[1]: Entering directory '/<>' Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Reading human autosomal references from autosomal_references.gz. Autosomal references for human: I II III Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Loading TSS file 'hg19.tss.refseq.bed.gz'. Excluding TSS [chr11 10530722 10530723 MTRNR2L8 0 -] which overlaps excluded region [chr11 10529403 10531969 Low_mappability_island 1000 .] Excluding TSS [chr12 118573688 118573689 PEBP1 0 +] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding TSS [chr14 105196180 105196181 ADSSL1 0 +] which overlaps excluded region [chr14 105195912 105196275 TAR1 1000 .] Excluding TSS [chr17 22022436 22022437 MTRNR2L1 0 +] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding TSS [chr20 55934877 55934878 MTRNR2L3 0 -] which overlaps excluded region [chr20 55932703 55936114 chrM 1000 .] Excluding TSS [chr5 79946853 79946854 MTRNR2L2 0 -] which overlaps excluded region [chr5 79945807 79948223 Low_mappability_island 1000 .] Excluding TSS [chr6 62284007 62284008 MTRNR2L9 0 +] which overlaps excluded region [chr6 62283966 62284581 Low_mappability_island 1000 .] Excluding TSS [chr7 57207570 57207571 ZNF479 0 -] which overlaps excluded region [chr7 57205319 57210318 BSR/Beta 1000 .] Excluding TSS [chr7 63688851 63688852 ZNF679 0 +] which overlaps excluded region [chr7 63686197 63693336 BSR/Beta 1000 .] Excluding TSS [chr7 142374130 142374131 MTRNR2L6 0 +] which overlaps excluded region [chr7 142372972 142375638 Low_mappability_island 1000 .] Excluding TSS [chrX 55208943 55208944 MTRNR2L10 0 -] which overlaps excluded region [chrX 55204685 55210460 chrM 1000 .] Excluding TSS [chrY 25130409 25130410 BPY2B 0 +] which overlaps excluded region [chrY 25122419 25160800 BSR/Beta 1000 .] Excluding TSS [chrY 26764150 26764151 BPY2B 0 +] which overlaps excluded region [chrY 26756160 26794538 BSR/Beta 1000 .] Excluding TSS [chrY 27198250 27198251 BPY2B 0 -] which overlaps excluded region [chrY 27167859 27206241 BSR/Beta 1000 .] chr1 feature count: 2687 chr2 feature count: 1715 chr3 feature count: 1490 chr4 feature count: 1004 chr5 feature count: 1132 chr6 feature count: 1368 chr7 feature count: 1169 chr8 feature count: 913 chr9 feature count: 1025 chr10 feature count: 1039 chr11 feature count: 1642 chr12 feature count: 1350 chr13 feature count: 433 chr14 feature count: 785 chr15 feature count: 812 chr16 feature count: 1106 chr17 feature count: 1528 chr18 feature count: 398 chr19 feature count: 1785 chr20 feature count: 694 chr21 feature count: 321 chr22 feature count: 593 Loaded 24989 TSS in 1.21877 seconds. (20503.4 TSS/second). Collecting metrics from test.bam. Logging problematic reads to SRR891275.problems. Loading peaks for read group SRR891275 from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 8.92591 seconds. (4176.16 peaks/second). Logging problematic reads to SRR891278.problems. Loading peaks for read group SRR891278 from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 8.7683 seconds. (4251.22 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 53 from [SRR891275.421 1187 chr1 569924 15 50M = 569927 53 TGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACC CCCFFFFFGHHHHIGIJIJIEHIGIIIJJGIJJJJGGGJJJJJGIIJJFI XA:Z:chrM,+9376,50M,1; MD:Z:50 NM:i:0 AS:i:50 XS:i:47 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 67 from [SRR891275.1617 99 chr1 2059335 60 50M = 2059352 67 CACCTTAGCTCTGGACACGAATTTGCGGTCATTGCTGTTCTTGTGTCTCT ???DB?D8C:CD42C<<*?DB<9?BBBD?9DD4 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 112 from [SRR891275.176 99 chr1 2419720 60 50M = 2419782 112 ATCCCTGGGACTGTAGGTGGGAAGGGCATTGCAAGGCACAGGGGCGGGGA @BCFFDEDDHHHHHIJICGHI=GHIGIJJJJJIJIJIGHFHIJBHHDB87 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 216 from [SRR891275.1770 163 chr1 18154381 60 50M = 18154547 216 CAACTGTTTTGCTTACTCTGACTAATACAGAGAAGGGAGCCACAATATAC C@CFFFDFGHHHHJJJJJJJJJJJJJIEIIHIJJJIGIJIJJJCHHIJJJ MD:Z:50 NM:i:0 AS:i:50 XS:i:21 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 5: 439 (84.423%) 10: 439 (84.423%) 15: 438 (84.231%) 20: 436 (83.846%) 25: 435 (83.654%) 30: 420 (80.769%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 23 (11.500% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (1.000% of all high quality autosomal alignments) Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) Top 100 peaks: 23 (11.500% of all high quality autosomal alignments) Top 1000 peaks: 23 (11.500% of all high quality autosomal alignments) Top 10,000 peaks: 23 (11.500% of all high quality autosomal alignments) Read Group ========== ID: SRR891278 Library: SRR891278 Sample: GSM1155967 Description: a library of brutal tests? Sequencing center: Sequencing date: Sequencing platform: ILLUMINA Platform model: Platform unit: Flow order: Key sequence: Predicted median insert size: Programs: Metrics ------- Read Mapping Metrics -------------------- Total reads: 520 Total problems: 90 (17.308%) Properly paired and mapped reads: 430 (82.692%) Secondary reads: 10 (1.923%) Supplementary reads: 0 (0.000%) Duplicate reads: 158 (30.385% of all reads) Quality Indicators ------------------ Short to mononucleosomal ratio: 2.357 High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 200 as a percentage of autosomal reads: 91.743% as a percentage of all reads: 38.462% TSS enrichment: 3.687 Paired Read Metrics ------------------- Paired reads: 520 (100.000%) Paired and mapped reads: 440 (84.615%) FR reads: 430 (82.692308%) First of pair: 259 (49.808%) Second of pair: 261 (50.192%) Forward reads: 261 (50.192%) Reverse reads: 259 (49.808%) Forward mate reads: 260 (50.000%) Reverse mate reads: 260 (50.000%) Unmapped Read Metrics --------------------- Unmapped reads: 8 (1.538%) Unmapped mate reads: 4 (0.769%) Reads not passing quality controls: 0 (0.000%) Unpaired reads: 0 (0.000%) Reads with zero mapping quality: 49 (9.423%) Aberrant Mapping Metrics ------------------------ RF reads: 6 (1.153846%) FF reads: 4 (0.769231%) RR reads: 9 (1.730769%) Reads that paired and mapped but... on different chromosomes: 8 (1.538%) probably too far from their mates: 2 (0.385%) (longest proper fragment seems to be 649) just not properly: 0 (0.000%) Autosomal/Mitochondrial Metrics ------------------------------- Total autosomal reads: 218 (41.923% of all reads) Total mitochondrial reads: 192 (36.923% of all reads) Duplicate autosomal reads: 17 (7.798% of all autosomal reads) Duplicate mitochondrial reads: 92 (47.917% of all mitochondrial reads) Mapping Quality --------------- Mean MAPQ: 48.044 Median MAPQ: 60.000 Reads with MAPQ >=... 5: 449 (86.346%) 10: 445 (85.577%) 15: 443 (85.192%) 20: 442 (85.000%) 25: 442 (85.000%) 30: 417 (80.192%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 92 (46.000% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (1.000% of all high quality autosomal alignments) Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) Top 100 peaks: 92 (46.000% of all high quality autosomal alignments) Top 1000 peaks: 92 (46.000% of all high quality autosomal alignments) Top 10,000 peaks: 92 (46.000% of all high quality autosomal alignments) [E::hts_open_format] Failed to open file "missing_alignment_file.bam" : No such file or directory Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Collecting metrics from test.bam. Logging problematic reads to Test collector.problems. Loading peaks for read group Test collector from test.peaks.gz. Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000.000 .] Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000.000 .] Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000.000 .] Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000.000 .] Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000.000 .] Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000.000 .] Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000.000 .] Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000.000 .] Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000.000 .] Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000.000 .] Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000.000 .] Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000.000 .] Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000.000 .] Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000.000 .] Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000.000 .] Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000.000 .] Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000.000 .] Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000.000 .] Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000.000 .] Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000.000 .] Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000.000 .] Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000.000 .] Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000.000 .] Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000.000 .] Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000.000 .] Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000.000 .] Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000.000 .] Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000.000 .] Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000.000 .] Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000.000 .] Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000.000 .] Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000.000 .] Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000.000 .] Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000.000 .] Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000.000 .] Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000.000 .] Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000.000 .] Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000.000 .] Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000.000 .] Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000.000 .] Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000.000 .] Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000.000 .] Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000.000 .] Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000.000 .] Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000.000 .] Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000.000 .] Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000.000 .] Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000.000 .] Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000.000 .] Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000.000 .] Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000.000 .] Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000.000 .] Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000.000 .] Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000.000 .] Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000.000 .] Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000.000 .] Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000.000 .] Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000.000 .] Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000.000 .] Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000.000 .] Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000.000 .] Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000.000 .] chr1 peak count: 3667 chr2 peak count: 3154 chr3 peak count: 2528 chr4 peak count: 1814 chr5 peak count: 2042 chr6 peak count: 2483 chr7 peak count: 1999 chr8 peak count: 1647 chr9 peak count: 1475 chr10 peak count: 1815 chr11 peak count: 1878 chr12 peak count: 2078 chr13 peak count: 1026 chr14 peak count: 1275 chr15 peak count: 1140 chr16 peak count: 1211 chr17 peak count: 1664 chr18 peak count: 772 chr19 peak count: 1595 chr20 peak count: 864 chr21 peak count: 487 chr22 peak count: 662 Loaded 37276 peaks in 8.799 seconds. (4236.532 peaks/second). New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 5: 888 (85.385%) 10: 884 (85.000%) 15: 881 (84.712%) 20: 878 (84.423%) 25: 877 (84.327%) 30: 837 (80.481%) Peak Metrics ------------ Peak count: 37276 High quality autosomal alignments that overlapped peaks: 115 (28.750% of all high quality autosomal alignments) Number of high quality autosomal alignments overlapping the top 10,000 peaks: Top peak: 2 (0.500% of all high quality autosomal alignments) Top 10 peaks: 20 (5.000% of all high quality autosomal alignments) Top 100 peaks: 115 (28.750% of all high quality autosomal alignments) Top 1000 peaks: 115 (28.750% of all high quality autosomal alignments) Top 10,000 peaks: 115 (28.750% of all high quality autosomal alignments) Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Collecting metrics from test.bam. Logging problematic reads to Test collector.problems. Loading peaks for read group Test collector from notthere.peaks.gz. Read 411 excluded regions from exclude.dac.bed.gz. Read 1649 excluded regions from exclude.duke.bed.gz. Loading TSS file 'notthere.bed.gz'. [E::sam_format1_append] Corrupted aux data for read SRR891268.122333488 =============================================================================== All tests passed (241 assertions in 54 test cases) make[1]: Leaving directory '/<>' create-stamp debian/debhelper-build-stamp dh_prep debian/rules override_dh_auto_install make[1]: Entering directory '/<>' dh_auto_install -- prefix=/usr make -j4 install DESTDIR=/<>/ataqv-1.3.1\+ds/debian/ataqv AM_UPDATE_INFO_DIR=no "INSTALL=install --strip-program=true" prefix=/usr make[2]: Entering directory '/<>' Installing to /usr install -d -m 0755 /<>/debian/ataqv/usr/bin install -d -m 0755 /<>/debian/ataqv/usr/bin install -d -m 0755 /<>/debian/ataqv/usr/share/ataqv/web for f in src/scripts/make_ataqv_pipeline src/scripts/mkarv src/scripts/run_ataqv_example src/scripts/srvarv; do sed -e 's/{{VERSION}}/1.3.1/g' $f > build/$(basename $f); install -m 0755 build/$(basename $f) /<>/debian/ataqv/usr/bin; done install -m 0755 build/ataqv /<>/debian/ataqv/usr/bin cp -a src/web/* /<>/debian/ataqv/usr/share/ataqv/web find /<>/debian/ataqv/usr/share/ataqv/web -type d -exec chmod 755 {} \; find /<>/debian/ataqv/usr/share/ataqv/web -type f -exec chmod 644 {} \; make[2]: Leaving directory '/<>' make[1]: Leaving directory '/<>' dh_install dh_installdocs dh_installchangelogs dh_installexamples debian/rules override_dh_installman make[1]: Entering directory '/<>' help2man --no-info --name="QC metrics for ATAC-seq data" build/ataqv > debian/ataqv.1 help2man --no-info --name="Turns ataqv results into a web app" src/scripts/mkarv > debian/mkarv.1 help2man --no-info --name="serve an instance of the ataqv web results viewer" --version-string 1.3.1+ds src/scripts/srvarv > debian/srvarv.1 dh_installman make[1]: Leaving directory '/<>' dh_perl dh_link dh_strip_nondeterminism dh_compress dh_fixperms dh_missing dh_dwz -a dh_strip -a debugedit: debian/ataqv/usr/lib/ataqv/run_ataqv_tests: Unknown DWARF DW_FORM_0x1f20 6d7e4933f541143e6f4058376d0b7298555170cd debugedit: debian/ataqv/usr/bin/ataqv: Unknown DWARF DW_FORM_0x1f20 ac3ae91b565d962d9b50cf58076fb27d372b1973 dh_makeshlibs -a dh_shlibdeps -a dh_installdeb dh_gencontrol dh_md5sums dh_builddeb INFO: pkgstriptranslations version 154 INFO: pkgstriptranslations version 154 pkgstriptranslations: processing ataqv-dbgsym (in debian/.debhelper/ataqv/dbgsym-root); do_strip: , oemstrip: pkgstriptranslations: processing ataqv (in debian/ataqv); do_strip: , oemstrip: pkgmaintainermangler: Maintainer field overridden to "Ubuntu Developers " pkgmaintainermangler: Maintainer field overridden to "Ubuntu Developers " pkgstripfiles: processing control file: debian/.debhelper/ataqv/dbgsym-root/DEBIAN/control, package ataqv-dbgsym, directory debian/.debhelper/ataqv/dbgsym-root dpkg-deb: building package 'ataqv-dbgsym' in 'debian/.debhelper/scratch-space/build-ataqv/ataqv-dbgsym_1.3.1+ds-2build1_amd64.deb'. pkgstripfiles: processing control file: debian/ataqv/DEBIAN/control, package ataqv, directory debian/ataqv pkgstripfiles: Running PNG optimization (using 4 cpus) for package ataqv ... pkgstripfiles: No PNG files. dpkg-deb: building package 'ataqv' in '../ataqv_1.3.1+ds-2build1_amd64.deb'. Renaming ataqv-dbgsym_1.3.1+ds-2build1_amd64.deb to ataqv-dbgsym_1.3.1+ds-2build1_amd64.ddeb dpkg-genbuildinfo --build=binary -O../ataqv_1.3.1+ds-2build1_amd64.buildinfo dpkg-genchanges --build=binary -mLaunchpad Build Daemon -O../ataqv_1.3.1+ds-2build1_amd64.changes dpkg-genchanges: info: binary-only upload (no source code included) dpkg-source --after-build . dpkg-buildpackage: info: binary-only upload (no source included) -------------------------------------------------------------------------------- Build finished at 2023-12-19T15:09:32Z Finished -------- I: Built successfully +------------------------------------------------------------------------------+ | Changes | +------------------------------------------------------------------------------+ ataqv_1.3.1+ds-2build1_amd64.changes: ------------------------------------- Format: 1.8 Date: Tue, 19 Dec 2023 15:45:54 +0100 Source: ataqv Binary: ataqv Built-For-Profiles: noudeb Architecture: amd64 Version: 1.3.1+ds-2build1 Distribution: noble-proposed Urgency: medium Maintainer: Launchpad Build Daemon Changed-By: Matthias Klose Description: ataqv - ATAC-seq QC and visualization Changes: ataqv (1.3.1+ds-2build1) noble; urgency=medium . * No-change rebuild for boost defaults change. Checksums-Sha1: 0202cb7a5bee99e4e776ff0851b7837ea51cbbcf 5019430 ataqv-dbgsym_1.3.1+ds-2build1_amd64.ddeb 053b635fd7f8a0f2c5e40f633a88d93171559dd9 9507 ataqv_1.3.1+ds-2build1_amd64.buildinfo 53855d549233034585b9cb01e3c3a965594e7aab 3410174 ataqv_1.3.1+ds-2build1_amd64.deb Checksums-Sha256: 139ac3585cd9604cbf8e1d481309d05997ae1601344fb24639d1b285a6745310 5019430 ataqv-dbgsym_1.3.1+ds-2build1_amd64.ddeb 541fd0821a1a1b4893493a7c4334f9fe926eb962e09f6e9b52f0608c35e8b5d1 9507 ataqv_1.3.1+ds-2build1_amd64.buildinfo b162ce336bdc18995ba5fd2fd139a3e2211dda5d9df20736c32dbe2b0824177a 3410174 ataqv_1.3.1+ds-2build1_amd64.deb Files: cc5f6fe508b700171d0d4ec7628ec38f 5019430 debug optional ataqv-dbgsym_1.3.1+ds-2build1_amd64.ddeb dbf9ce0ef4ff39a1e7b7b8139026e8bb 9507 science optional ataqv_1.3.1+ds-2build1_amd64.buildinfo 1057175d409fe2b991901073bb9bd1c1 3410174 science optional ataqv_1.3.1+ds-2build1_amd64.deb /<>/ataqv_1.3.1+ds-2build1_amd64.changes.new could not be renamed to /<>/ataqv_1.3.1+ds-2build1_amd64.changes: Illegal seek Distribution field may be wrong!!! +------------------------------------------------------------------------------+ | Buildinfo | +------------------------------------------------------------------------------+ Format: 1.0 Source: ataqv Binary: ataqv ataqv-dbgsym Architecture: amd64 Version: 1.3.1+ds-2build1 Checksums-Md5: cc5f6fe508b700171d0d4ec7628ec38f 5019430 ataqv-dbgsym_1.3.1+ds-2build1_amd64.ddeb 1057175d409fe2b991901073bb9bd1c1 3410174 ataqv_1.3.1+ds-2build1_amd64.deb Checksums-Sha1: 0202cb7a5bee99e4e776ff0851b7837ea51cbbcf 5019430 ataqv-dbgsym_1.3.1+ds-2build1_amd64.ddeb 53855d549233034585b9cb01e3c3a965594e7aab 3410174 ataqv_1.3.1+ds-2build1_amd64.deb Checksums-Sha256: 139ac3585cd9604cbf8e1d481309d05997ae1601344fb24639d1b285a6745310 5019430 ataqv-dbgsym_1.3.1+ds-2build1_amd64.ddeb b162ce336bdc18995ba5fd2fd139a3e2211dda5d9df20736c32dbe2b0824177a 3410174 ataqv_1.3.1+ds-2build1_amd64.deb Build-Origin: Ubuntu Build-Architecture: amd64 Build-Date: Tue, 19 Dec 2023 15:09:31 +0000 Build-Path: /<> Build-Tainted-By: merged-usr-via-aliased-dirs usr-local-has-programs Installed-Build-Depends: autoconf (= 2.71-3), automake (= 1:1.16.5-1.3), autopoint (= 0.21-14), autotools-dev (= 20220109.1), base-files (= 13ubuntu5), base-passwd (= 3.6.3), bash (= 5.2.21-2ubuntu1), binutils (= 2.41.50.20231214-1ubuntu1), binutils-common (= 2.41.50.20231214-1ubuntu1), binutils-x86-64-linux-gnu (= 2.41.50.20231214-1ubuntu1), bsdextrautils (= 2.39.2-6ubuntu1), bsdutils (= 1:2.39.2-6ubuntu1), build-essential (= 12.10ubuntu1), bzip2 (= 1.0.8-5build1), coreutils (= 9.4-2ubuntu1), cpp (= 4:13.2.0-2ubuntu1), cpp-13 (= 13.2.0-9ubuntu1), dash (= 0.5.12-6ubuntu1), debconf (= 1.5.82), debhelper (= 13.11.8ubuntu1), debianutils (= 5.14), debugedit (= 1:5.0-5), dh-autoreconf (= 20), dh-strip-nondeterminism (= 1.13.1-1), diffutils (= 1:3.10-1), dpkg (= 1.22.1ubuntu5), dpkg-dev (= 1.22.1ubuntu5), dwz (= 0.15-1), file (= 1:5.45-2), findutils (= 4.9.0-5), fonts-font-awesome (= 5.0.10+really4.7.0~dfsg-4.1), g++ (= 4:13.2.0-2ubuntu1), g++-13 (= 13.2.0-9ubuntu1), gcc (= 4:13.2.0-2ubuntu1), gcc-13 (= 13.2.0-9ubuntu1), gcc-13-base (= 13.2.0-9ubuntu1), gettext (= 0.21-14), gettext-base (= 0.21-14), grep (= 3.11-3), groff-base (= 1.23.0-3), gzip (= 1.12-1ubuntu1), help2man (= 1.49.3), hostname (= 3.23+nmu1ubuntu1), icu-devtools (= 74.2-1ubuntu1), init-system-helpers (= 1.66ubuntu1), intltool-debian (= 0.35.0+20060710.6), libacl1 (= 2.3.1-3), libarchive-zip-perl (= 1.68-1), libasan8 (= 13.2.0-9ubuntu1), libatomic1 (= 13.2.0-9ubuntu1), libattr1 (= 1:2.5.1-4), libaudit-common (= 1:3.1.2-1), libaudit1 (= 1:3.1.2-1), libbinutils (= 2.41.50.20231214-1ubuntu1), libblkid1 (= 2.39.2-6ubuntu1), libboost-atomic1.83-dev (= 1.83.0-1ubuntu3), libboost-atomic1.83.0 (= 1.83.0-1ubuntu3), libboost-chrono-dev (= 1.83.0.1ubuntu2), libboost-chrono1.83-dev (= 1.83.0-1ubuntu3), libboost-chrono1.83.0 (= 1.83.0-1ubuntu3), libboost-filesystem-dev (= 1.83.0.1ubuntu2), libboost-filesystem1.83-dev (= 1.83.0-1ubuntu3), libboost-filesystem1.83.0 (= 1.83.0-1ubuntu3), libboost-iostreams-dev (= 1.83.0.1ubuntu2), libboost-iostreams1.83-dev (= 1.83.0-1ubuntu3), libboost-iostreams1.83.0 (= 1.83.0-1ubuntu3), libboost-regex1.83-dev (= 1.83.0-1ubuntu3), libboost-regex1.83.0 (= 1.83.0-1ubuntu3), libboost-system-dev (= 1.83.0.1ubuntu2), libboost-system1.83-dev (= 1.83.0-1ubuntu3), libboost-system1.83.0 (= 1.83.0-1ubuntu3), libboost1.83-dev (= 1.83.0-1ubuntu3), libbrotli1 (= 1.1.0-2), libbz2-1.0 (= 1.0.8-5build1), libc-bin (= 2.38-3ubuntu1), libc-dev-bin (= 2.38-3ubuntu1), libc6 (= 2.38-3ubuntu1), libc6-dev (= 2.38-3ubuntu1), libcap-ng0 (= 0.8.3-3), libcap2 (= 1:2.66-4ubuntu1), libcc1-0 (= 13.2.0-9ubuntu1), libcom-err2 (= 1.47.0-2ubuntu1), libcrypt-dev (= 1:4.4.36-2), libcrypt1 (= 1:4.4.36-2), libctf-nobfd0 (= 2.41.50.20231214-1ubuntu1), libctf0 (= 2.41.50.20231214-1ubuntu1), libcurl3-gnutls (= 8.4.0-2ubuntu1), libcurl4-gnutls-dev (= 8.4.0-2ubuntu1), libdb5.3 (= 5.3.28+dfsg2-4), libdebconfclient0 (= 0.271ubuntu1), libdebhelper-perl (= 13.11.8ubuntu1), libdeflate-dev (= 1.18-1), libdeflate0 (= 1.18-1), libdpkg-perl (= 1.22.1ubuntu5), libdw1 (= 0.190-1), libelf1 (= 0.190-1), libexpat1 (= 2.5.0-2), libffi8 (= 3.4.4-2), libfile-stripnondeterminism-perl (= 1.13.1-1), libgcc-13-dev (= 13.2.0-9ubuntu1), libgcc-s1 (= 13.2.0-9ubuntu1), libgcrypt20 (= 1.10.2-3ubuntu1), libgdbm-compat4 (= 1.23-5), libgdbm6 (= 1.23-5), libgmp10 (= 2:6.3.0+dfsg-2ubuntu4), libgnutls30 (= 3.8.1-4ubuntu6), libgomp1 (= 13.2.0-9ubuntu1), libgpg-error0 (= 1.47-3build1), libgprofng0 (= 2.41.50.20231214-1ubuntu1), libgssapi-krb5-2 (= 1.20.1-5build1), libhogweed6 (= 3.9.1-2), libhts-dev (= 1.18+ds-1), libhts3 (= 1.18+ds-1), libhtscodecs2 (= 1.6.0-1), libhwasan0 (= 13.2.0-9ubuntu1), libicu-dev (= 74.2-1ubuntu1), libicu74 (= 74.2-1ubuntu1), libidn2-0 (= 2.3.4-1build1), libisl23 (= 0.26-3), libitm1 (= 13.2.0-9ubuntu1), libjansson4 (= 2.14-2), libjs-d3-format (= 1:1.4.5+~1.4.2-2), libjs-jquery (= 3.6.1+dfsg+~3.5.14-1), libjs-jquery-datatables (= 1.11.5+dfsg-2), libjs-jquery-datatables-extensions (= 0.0+git20150910.28fd64e+dfsg-5), libk5crypto3 (= 1.20.1-5build1), libkeyutils1 (= 1.6.3-2), libkrb5-3 (= 1.20.1-5build1), libkrb5support0 (= 1.20.1-5build1), libldap2 (= 2.6.6+dfsg-1~exp1ubuntu1), liblocale-gettext-perl (= 1.07-6), liblsan0 (= 13.2.0-9ubuntu1), liblz4-1 (= 1.9.4-1), liblzma-dev (= 5.4.5-0.1), liblzma5 (= 5.4.5-0.1), libmagic-mgc (= 1:5.45-2), libmagic1 (= 1:5.45-2), libmd0 (= 1.1.0-1), libmount1 (= 2.39.2-6ubuntu1), libmpc3 (= 1.3.1-1), libmpfr6 (= 4.2.1-1), libncurses-dev (= 6.4+20231209-1), libncurses6 (= 6.4+20231209-1), libncursesw6 (= 6.4+20231209-1), libnettle8 (= 3.9.1-2), libnghttp2-14 (= 1.58.0-1), libnsl-dev (= 1.3.0-3), libnsl2 (= 1.3.0-3), libp11-kit0 (= 0.25.3-2ubuntu2), libpam-modules (= 1.5.2-9.1ubuntu1), libpam-modules-bin (= 1.5.2-9.1ubuntu1), libpam-runtime (= 1.5.2-9.1ubuntu1), libpam0g (= 1.5.2-9.1ubuntu1), libpcre2-8-0 (= 10.42-4ubuntu1), libperl5.36 (= 5.36.0-10ubuntu1), libpipeline1 (= 1.5.7-1), libpsl5 (= 0.21.2-1build1), libpython3-stdlib (= 3.11.4-5ubuntu1), libpython3.11-minimal (= 3.11.7-2), libpython3.11-stdlib (= 3.11.7-2), libquadmath0 (= 13.2.0-9ubuntu1), libreadline8 (= 8.2-3), librtmp1 (= 2.4+20151223.gitfa8646d.1-2build4), libsasl2-2 (= 2.1.28+dfsg1-4), libsasl2-modules-db (= 2.1.28+dfsg1-4), libseccomp2 (= 2.5.4-2ubuntu1), libselinux1 (= 3.5-1build2), libsframe1 (= 2.41.50.20231214-1ubuntu1), libsmartcols1 (= 2.39.2-6ubuntu1), libsqlite3-0 (= 3.44.2-1), libssh-4 (= 0.10.5-3ubuntu1), libssl3 (= 3.0.10-1ubuntu3), libstdc++-13-dev (= 13.2.0-9ubuntu1), libstdc++6 (= 13.2.0-9ubuntu1), libsub-override-perl (= 0.10-1), libsystemd0 (= 255-1ubuntu1), libtasn1-6 (= 4.19.0-3), libtinfo6 (= 6.4+20231209-1), libtirpc-common (= 1.3.4+ds-1), libtirpc-dev (= 1.3.4+ds-1), libtirpc3 (= 1.3.4+ds-1), libtool (= 2.4.7-7), libtsan2 (= 13.2.0-9ubuntu1), libubsan1 (= 13.2.0-9ubuntu1), libuchardet0 (= 0.0.8-1), libudev1 (= 255-1ubuntu1), libunistring5 (= 1.1-2), libuuid1 (= 2.39.2-6ubuntu1), libxml2 (= 2.9.14+dfsg-1.3build3), libzstd1 (= 1.5.5+dfsg2-2), linux-libc-dev (= 6.6.0-14.14), login (= 1:4.13+dfsg1-3ubuntu1), lto-disabled-list (= 44), m4 (= 1.4.19-4), make (= 4.3-4.1build1), man-db (= 2.12.0-1), mawk (= 1.3.4.20231126-1), media-types (= 10.1.0), ncurses-base (= 6.4+20231209-1), ncurses-bin (= 6.4+20231209-1), netbase (= 6.4), node-commander (= 9.4.1-1), node-d3 (= 5.16.0+~cs5.28.10-1), node-d3-array (= 3.2.0+~cs5.0.6-2), node-d3-axis (= 1.0.12+~1.0.16-1), node-d3-brush (= 1.1.6+~1.1.5-1), node-d3-chord (= 1.0.6+~1.0.11-1), node-d3-collection (= 1.0.7+~1.0.10-1), node-d3-color (= 1.4.1+~1.4.2-1), node-d3-contour (= 1.3.2+~1.3.3-1), node-d3-dispatch (= 1.0.6+~1.0.9-1), node-d3-drag (= 1.2.5+~1.2.5-1), node-d3-dsv (= 1.2.0+~1.2.3-1), node-d3-ease (= 1.0.7+~1.0.11-1), node-d3-fetch (= 1.2.0+~1.2.2-1), node-d3-force (= 2.1.1+~2.1.4-1), node-d3-format (= 1:1.4.5+~1.4.2-2), node-d3-geo (= 1.12.1+~1.12.4-1), node-d3-hierarchy (= 1.1.9+~1.1.8-1), node-d3-interpolate (= 1.4.0+~1.4.2-1), node-d3-path (= 1.0.9+~1.0.9-1), node-d3-polygon (= 1.0.6+~1.0.8-1), node-d3-quadtree (= 1.0.7+~1.0.9-1), node-d3-queue (= 3.0.7-13), node-d3-random (= 1.1.2+~1.1.3-1), node-d3-scale (= 2.2.2+~2.2.6-1), node-d3-scale-chromatic (= 1.5.0+~1.5.1-1), node-d3-selection (= 1.4.1+~1.4.3-1), node-d3-shape (= 1.3.7+~1.3.8-1), node-d3-time (= 1.1.0+~1.1.1-1), node-d3-time-format (= 2.3.0+~2.3.1-1), node-d3-timer (= 1.0.10+~1.0.10-1), node-d3-transition (= 1.3.2+~1.3.2-1), node-d3-voronoi (= 1.1.4+~1.1.9-1), node-d3-zoom (= 1.8.3+~1.8.4-1), node-iconv-lite (= 0.6.3-3), node-normalize.css (= 8.0.1-5), node-rw (= 1.3.3-5), node-safe-buffer (= 5.2.1+~cs2.1.2-3), patch (= 2.7.6-7build2), perl (= 5.36.0-10ubuntu1), perl-base (= 5.36.0-10ubuntu1), perl-modules-5.36 (= 5.36.0-10ubuntu1), po-debconf (= 1.0.21+nmu1), python3 (= 3.11.4-5ubuntu1), python3-minimal (= 3.11.4-5ubuntu1), python3.11 (= 3.11.7-2), python3.11-minimal (= 3.11.7-2), readline-common (= 8.2-3), rpcsvc-proto (= 1.4.2-0ubuntu6), sed (= 4.9-1), sensible-utils (= 0.0.20), sysvinit-utils (= 3.08-3ubuntu1), tar (= 1.34+dfsg-1.2ubuntu2), tzdata (= 2023c-9ubuntu1), util-linux (= 2.39.2-6ubuntu1), xz-utils (= 5.4.5-0.1), zlib1g (= 1:1.3.dfsg-3ubuntu1), zlib1g-dev (= 1:1.3.dfsg-3ubuntu1) Environment: DEB_BUILD_OPTIONS="parallel=4" DEB_BUILD_PROFILES="noudeb" LANG="C.UTF-8" LC_ALL="C.UTF-8" SOURCE_DATE_EPOCH="1702997154" +------------------------------------------------------------------------------+ | Package contents | +------------------------------------------------------------------------------+ ataqv_1.3.1+ds-2build1_amd64.deb -------------------------------- new Debian package, version 2.0. size 3410174 bytes: control archive=1737 bytes. 1054 bytes, 17 lines control 2422 bytes, 32 lines md5sums Package: ataqv Version: 1.3.1+ds-2build1 Architecture: amd64 Maintainer: Ubuntu Developers Original-Maintainer: Debian Med Packaging Team Installed-Size: 6189 Depends: libboost-chrono1.83.0 (>= 1.83.0), libboost-filesystem1.83.0 (>= 1.83.0), libboost-iostreams1.83.0 (>= 1.83.0), libc6 (>= 2.38), libgcc-s1 (>= 3.3.1), libhts3 (>= 1.17), libncurses6 (>= 6), libstdc++6 (>= 13.1), libjs-jquery, libjs-jquery-datatables, libjs-jquery-datatables-extensions, fonts-font-awesome, node-normalize.css, python3, node-d3 Suggests: picard-tools, samtools, macs, wget Section: science Priority: optional Homepage: https://github.com/ParkerLab/ataqv/ Description: ATAC-seq QC and visualization A toolkit for measuring and comparing ATAC-seq results, made in the Parker lab at the University of Michigan. They wrote it to help understand how well their ATAC-seq assays had worked, and to make it easier to spot differences that might be caused by library prep or sequencing. drwxr-xr-x root/root 0 2023-12-19 14:45 ./ drwxr-xr-x root/root 0 2023-12-19 14:45 ./usr/ drwxr-xr-x root/root 0 2023-12-19 14:45 ./usr/bin/ -rwxr-xr-x root/root 437400 2023-12-19 14:45 ./usr/bin/ataqv -rwxr-xr-x root/root 3020 2023-12-19 14:45 ./usr/bin/make_ataqv_pipeline -rwxr-xr-x root/root 36049 2023-12-19 14:45 ./usr/bin/mkarv -rwxr-xr-x root/root 1634 2023-12-19 14:45 ./usr/bin/run_ataqv_example -rwxr-xr-x root/root 1142 2023-12-19 14:45 ./usr/bin/srvarv drwxr-xr-x root/root 0 2023-12-19 14:45 ./usr/lib/ drwxr-xr-x root/root 0 2023-12-19 14:45 ./usr/lib/ataqv/ -rwxr-xr-x root/root 924224 2023-12-19 14:45 ./usr/lib/ataqv/run_ataqv_tests drwxr-xr-x root/root 0 2023-12-19 14:45 ./usr/share/ drwxr-xr-x root/root 0 2023-12-19 14:45 ./usr/share/ataqv/ drwxr-xr-x root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/ drwxr-xr-x root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/css/ -rw-r--r-- root/root 18865 2023-02-17 16:44 ./usr/share/ataqv/web/css/ataqv.css lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/css/datatables.buttons.min.css -> ../../../javascript/jquery-datatables-extensions/Buttons/css/buttons.dataTables.min.css -rw-r--r-- root/root 3362 2023-02-17 16:44 ./usr/share/ataqv/web/css/datatables.fontawesome.css lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/css/datatables.min.css -> ../../../javascript/jquery-datatables/css/jquery.dataTables.min.css lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/css/font-awesome.min.css -> ../../../fonts-font-awesome/css/font-awesome.min.css lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/css/normalize.css -> ../../../javascript/normalize.css/normalize.css drwxr-xr-x root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/fonts/ lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/fonts/FontAwesome.otf -> ../../../fonts-font-awesome/fonts/FontAwesome.otf lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/fonts/fontawesome-webfont.eot -> ../../../fonts-font-awesome/fonts/fontawesome-webfont.eot lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/fonts/fontawesome-webfont.svg -> ../../../fonts-font-awesome/fonts/fontawesome-webfont.svg lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/fonts/fontawesome-webfont.ttf -> ../../../fonts-font-awesome/fonts/fontawesome-webfont.ttf lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/fonts/fontawesome-webfont.woff -> ../../../fonts-font-awesome/fonts/fontawesome-webfont.woff lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/fonts/fontawesome-webfont.woff2 -> ../../../fonts-font-awesome/fonts/fontawesome-webfont.woff2 -rw-r--r-- root/root 34052 2023-02-17 16:44 ./usr/share/ataqv/web/fonts/sourcesanspro-regular.woff -rw-r--r-- root/root 28724 2023-02-17 16:44 ./usr/share/ataqv/web/fonts/sourcesanspro-regularit.woff -rw-r--r-- root/root 33848 2023-02-17 16:44 ./usr/share/ataqv/web/fonts/sourcesanspro-semibold.woff -rw-r--r-- root/root 28624 2023-02-17 16:44 ./usr/share/ataqv/web/fonts/sourcesanspro-semiboldit.woff -rw-r--r-- root/root 51122 2023-12-19 14:45 ./usr/share/ataqv/web/index.html drwxr-xr-x root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/js/ -rw-r--r-- root/root 69250 2023-02-17 16:44 ./usr/share/ataqv/web/js/ataqv.js lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/js/buttons.colVis.min.js -> ../../../javascript/jquery-datatables-extensions/Buttons/js/buttons.colVis.min.js lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/js/buttons.html5.min.js -> ../../../javascript/jquery-datatables-extensions/Buttons/js/buttons.html5.min.js lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/js/buttons.print.min.js -> ../../../javascript/jquery-datatables-extensions/Buttons/js/buttons.print.min.js lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/js/d3.min.js -> ../../../nodejs/d3/dist/d3.min.js lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/js/dataTables.buttons.min.js -> ../../../javascript/jquery-datatables-extensions/Buttons/js/dataTables.buttons.min.js lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/js/dataTables.responsive.min.js -> ../../../javascript/jquery-datatables-extensions/Responsive/js/dataTables.responsive.min.js lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/js/jquery.dataTables.min.js -> ../../../javascript/jquery-datatables/jquery.dataTables.min.js lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/js/jquery.min.js -> ../../../javascript/jquery/jquery.min.js lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/js/jszip.min.js -> ../../../javascript/jquery-datatables-extensions/JSZip/jszip.min.js lrwxrwxrwx root/root 0 2023-12-19 14:45 ./usr/share/ataqv/web/js/pdfmake.min.js -> ../../../javascript/jquery-datatables-extensions/pdfmake/build/pdfmake.min.js drwxr-xr-x root/root 0 2023-12-19 14:45 ./usr/share/doc/ drwxr-xr-x root/root 0 2023-12-19 14:45 ./usr/share/doc/ataqv/ -rw-r--r-- root/root 6072 2023-02-17 16:44 ./usr/share/doc/ataqv/README.rst.gz -rw-r--r-- root/root 872 2023-12-19 14:45 ./usr/share/doc/ataqv/changelog.Debian.gz -rw-r--r-- root/root 8547 2023-12-14 15:46 ./usr/share/doc/ataqv/copyright drwxr-xr-x root/root 0 2023-12-19 14:45 ./usr/share/doc/ataqv/examples/ drwxr-xr-x root/root 0 2023-12-19 14:45 ./usr/share/doc/ataqv/examples/testdata/ -rw-r--r-- root/root 37149 2023-02-17 16:44 ./usr/share/doc/ataqv/examples/testdata/SRR891275.bam -rw-r--r-- root/root 773256 2023-02-17 16:44 ./usr/share/doc/ataqv/examples/testdata/SRR891275.bam.bai -rw-r--r-- root/root 418285 2023-12-19 14:45 ./usr/share/doc/ataqv/examples/testdata/SRR891275.peaks.gz -rw-r--r-- root/root 37198 2023-02-17 16:44 ./usr/share/doc/ataqv/examples/testdata/SRR891278.bam -rw-r--r-- root/root 952573 2023-12-19 14:45 ./usr/share/doc/ataqv/examples/testdata/SRR891278.peaks.gz -rw-r--r-- root/root 4708 2023-12-19 14:45 ./usr/share/doc/ataqv/examples/testdata/exclude.dac.bed.gz -rw-r--r-- root/root 17130 2023-12-19 14:45 ./usr/share/doc/ataqv/examples/testdata/exclude.duke.bed.gz -rw-r--r-- root/root 288924 2023-12-19 14:45 ./usr/share/doc/ataqv/examples/testdata/hg19.tss.refseq.bed.gz -rwxr-xr-x root/root 2617 2023-02-17 16:44 ./usr/share/doc/ataqv/examples/testdata/mktd.sh -rw-r--r-- root/root 72177 2023-02-17 16:44 ./usr/share/doc/ataqv/examples/testdata/test.bam -rw-r--r-- root/root 1017208 2023-02-17 16:44 ./usr/share/doc/ataqv/examples/testdata/test.bam.bai -rw-r--r-- root/root 968461 2023-12-19 14:45 ./usr/share/doc/ataqv/examples/testdata/test.peaks.gz drwxr-xr-x root/root 0 2023-12-19 14:45 ./usr/share/man/ drwxr-xr-x root/root 0 2023-12-19 14:45 ./usr/share/man/man1/ -rw-r--r-- root/root 2084 2023-12-19 14:45 ./usr/share/man/man1/ataqv.1.gz -rw-r--r-- root/root 1631 2023-12-19 14:45 ./usr/share/man/man1/mkarv.1.gz -rw-r--r-- root/root 381 2023-12-19 14:45 ./usr/share/man/man1/srvarv.1.gz +------------------------------------------------------------------------------+ | Post Build | +------------------------------------------------------------------------------+ +------------------------------------------------------------------------------+ | Cleanup | +------------------------------------------------------------------------------+ Purging /<> Not removing build depends: as requested +------------------------------------------------------------------------------+ | Summary | +------------------------------------------------------------------------------+ Build Architecture: amd64 Build Type: binary Build-Space: 153200 Build-Time: 82 Distribution: noble-proposed Host Architecture: amd64 Install-Time: 12 Job: ataqv_1.3.1+ds-2build1.dsc Machine Architecture: amd64 Package: ataqv Package-Time: 96 Source-Version: 1.3.1+ds-2build1 Space: 153200 Status: successful Version: 1.3.1+ds-2build1 -------------------------------------------------------------------------------- Finished at 2023-12-19T15:09:32Z Build needed 00:01:36, 153200k disk space RUN: /usr/share/launchpad-buildd/bin/in-target scan-for-processes --backend=chroot --series=noble --arch=amd64 PACKAGEBUILD-27576134 Scanning for processes to kill in build PACKAGEBUILD-27576134